Kelter P., Mosher M., Scott A. Chemistry. The Practical Science

Подождите немного. Документ загружается.

A38 Answers to Practice Exercises and Selected Exercises

7. four atoms 9. A, metal; B, molecular; C, ionic 11. a. 4.42 ×

−29

; b. 2.10 × 10

−28

; c. 6.23 × 10

−28

13. 0.559 g

15. 125 pm 17. 142 pm, 32.0% 19. 6.1 × 10

atoms per mole

21. Rh 23. Na, Al, Ca, Cr, Bi 25. one, three 27. metal (2.5

kJ/mol), semiconductor (85 kJ/mol), insulator (450 kJ/mol)

29. Since the valence electrons from the metals are free to travel in

the delocalized orbitals spanning the entire metal (the electron gas),

the remaining positive atomic cores are all attracted to the sea of

electrons that surrounds them. Because all cores are attracted, it

doesn’t matter what the speciﬁc identity of the metal is; all metals

can be accommodated in the metal alloy crystal lattice. 31. If one

considers a display of apples that is originally all one color (green,

for example), alloys can be created in two ways: a. Remove some of

the green apples and replace each, in that same position, with a red

apple. This represents a substitutional alloy; b. Place some smaller

red crabapples in the open spaces left between the green apples,

without rearranging the apples or removing any apples. This repre-

sents an interstitial alloy. 33. a. one; b. Sodium donates one orbital

to the metal “molecular” orbitals. The number of molecular orbitals

that are created must equal the number of atomic orbitals that were

used, with half being bonding and the other half antibonding. Be-

cause each orbital can hold two electrons and sodium donates only

one per atom, only half of the orbitals are ﬁlled. In other words, the

lower half, all bonding, are ﬁlled. Any transition from the highest oc-

cupied molecular orbital to the lowest unoccupied molecular orbital

will be a transition from a bonding orbital to an antibonding orbital.

35. 2.42 × 10

−19

J 37. Indium, from Group IIIA, has one fewer va-

lence electron than silicon. For each indium in the semiconductor,

there is one fewer electron (one more positive hole), making the

semiconductor p-type. 39. Adding boron to carbon results in fewer

electrons than pure carbon would have, creating openings in the va-

lence band and a larger gap to the conduction band than in pure car-

bon. There are now lower-energy transitions available within the va-

lence band. Because of these transitions, the electrons absorb some

visible light, leaving behind the blue color we see. 41. Ceramics are

characterized by ionic bonding, which has a very large gap between

the valence and conduction bands. A large amount of energy is re-

quired to bridge the gap, and very few (if any) electrons are pro-

moted into the conduction band. Without electrons in the conduc-

tion band, no (or very little) current can be conducted through the

ceramic. 43. Because the bonding in glass is very disordered and

random, different regions within the glass experience different local-

ized bonding strengths. Different amounts of energy will be required

to loosen up and melt these interactions, resulting in a range of

melting temperatures. 45. 1.2 m, 1.66 × 10

−25

47.

49. 7.51 g 51. a. plastic or metal; b. plastic; c. metal or plastic

53. All plastics are formed by the linking of several smaller mono-

mer units that are then thermally molded and hardened in a particu-

lar shape. DNA is a polymer, but because it is not thermally molded

and hardened, it is not a plastic. 55. a. plastic or metal; b. glass and

metal; c. plastic or metal; d. plastic, glass, ceramic, or metal 57. A

composite material used for automobile exteriors should be both

strong and lightweight in order to provide protection in crashes and

also to enhance the car’s performance or economy of operation by

reducing its weight. Composites tend to be expensive to produce.

59. Most of the bonds in most polymers are sigma bonds and are

strongly localized. The electrons are not free to conduct electricity.

–

61. 8.4 × 10

atoms 63. 7.67 × 10

atoms 65. 1.37 × 10

−6

4.12 × 10

−6

g 67. physical deposition or chemical-vapor deposi-

tion, depending on the exact process 69. the size of holes within

the zeolite 71. Televisions are made from many plastics, metals,

and glass and sometimes a large portion of lead. The plastics, metals,

and lead are often recycled. 73. The nucleic acids (DNA and RNA)

make up one class of biopolymers; a second class consists of proteins

(mostly enzymes); the third class consists of some carbohydrates, in-

cluding cellulose, chitin, and starches. 75. heterogeneous; It limits

the formation of waste by-products. 77. It is lighter, more insulat-

ing, and more ﬂexible. 79. Molecular solids do not conduct; ionic

solids, when molten or dissolved, do conduct. 81. Because so many

metal atoms are in the bulk form of a metal, and because each donates

an orbital to the overall molecular orbital, there are an extremely large

number of bonding and antibonding orbitals produced. Because the

molecular orbitals are so plentiful and close together, electrons can

absorb and release almost any wavelength of light from the infrared to

the ultraviolet. The result is the luster that we associate with metals.

83. See http://www.dnr.state.oh.us/recycling/awareness/facts/

tires/goodyear.htm 85. contamination of groundwater and drink-

ing water

86. a.

c. reacts with water, may be biodegradable; d. 0.558 g; e. acidic, but

does not react with water in ester cleavage

Chapter 14

P14.1 112 splits/256 combinations; 43.8% P14.2 All but photo-

synthesis are spontaneous. P14.3 a. not spontaneous; b. sponta-

neous; c. spontaneous P14.4 −209 J/K; 136 J/K P14.5 The

entropy change is positive for the ﬁrst reaction and negative for

the second. P14.6 109 J/K; −137 J/K P14.7 0.224 kJ/mol;

−0.986 kJ/mol P14.8 spontaneous (−2827 kJ); spontaneous

(−2074 kJ); spontaneous (−401 kJ) P14.9 337.2 K; 373.0 K

1. 16 3. 37.5% 5. A macrostate represents the total properties of

the system. A microstate is a representation of a single way to

arrange the parts of a system. 7. One possibility is all students in

one room with one seat between every student and the next. Another

possibility is half the students in each room with vacant seats be-

tween students. 9. 2

1000

= 1.07 × 10

301

. Because the number of mi-

crostates becomes very large, the number of individual microstates

that correspond with either exact or very close to exact even distrib-

utions is much larger than the number of unequally distributed mi-

crostates. 11. It has increased. We know that there have to be many

more microstates available after mixing, because the process is spon-

taneous, indicating a ﬁnal state with more available microstates.

13. Water evaporation only 15. a. At room temperature, burning

a piece of paper requires the intervention of a heater or ignition

source. b. Hard-boiling an egg requires the addition of heat.

c. Muscle mass is not added without a lot of work, such as lifting

weights. 17. The entropy of the universe decreases in a nonsponta-

neous process. 19. The greater the number of microstates, the

greater the entropy in a system. 21. The number of microstates

CH CH





Chapter 15 A39

corresponding to an even dispersal of the aroma-producing

molecules is much larger than the number of microstates in which

the aroma remains contained in one part of the room. The sponta-

neous process is then the dispersal of the aroma corresponding to

the greater number of microstates. 23. If the total entropy of the

universe increases, the process is spontaneous. The conversion of the

gasoline from a liquid to a gas involves a large increase in entropy,

which offsets the small decrease in entropy due to the removal of

heat (and therefore available microstates) from your hand. 25. The

change in entropy of the carbon dioxide is very large and positive as

the molecules go from solid to gas. Because the heat to sublime the

is taken from the environment, the nearby gases are cooled,

lowering their entropy, which is a negative entropy change. Because

the process is spontaneous, the entropy of the universe increases.

27. As the reaction proceeds from left to right, the number of moles

of gas is reduced. Removal of a mole of gas corresponds to a large

decrease in the entropy; therefore, a reaction from right to left will

cause an increase in the entropy of the system. 29. a. positive;

b. need more information; c. need more information 31. The more

ways a molecule can move, the greater the multiplicity in a system.

33. The entropy of the surroundings increases. 35. a. negative;

b. positive; c. positive 37. positive; For the CO

the transition from a

dissolved species, conﬁned to the liquid, to a gas with a muchgreater

available volume,represents a large increase in entropy.

39. 1

(g) + 5O

(g) → 3CO

(g) + 4H

O(g); 6 mol of reactants

gas; 7 mol of products gas; entropy increases. 41. 1

(l) +

(g) → 3CO

(g) + 4H

O(l); 5 mol of reactant gas; 3 mol of prod-

uct gas; entropy decreases. 43. Because the number of microstates

that become available in a gas rather than a liquid or solid is so large,

any conversion to a gas greatly inﬂuences the entropy. The change

in the number of microstates of liquids and solids is much lower

and inﬂuences the reaction much less. 45. a. negative; b. positive;

c. negative 46. a. −284.5 J/K; b. 216.5 J/K; c. −99.5 J/K

49. 1

OH(l) + 3O

(g) → 2CO

(g) + 3H

O(g); 219 J/K

51. 4 J/K 53. a. high temperature; b. none 55. a. 61.0 kJ/mol;

c. −1.59 × 10

kJ/mol 56. a. −97.7 kJ/mol; c. 507 kJ/mol

57. a. 938 J/K·mol; c. −2.42 × 10

J/K·mol 58. a. 1075 K; c. 769 K

59. a. spontaneous; b. nonspontaneous; c. spontaneous

61. −1.48 × 10

kJ 63. −71 kJ/mol 65. −532 kJ/mol; −122 J/K;

−446 kJ/mol 67. a. 1681 K; b. 138 K; c. 420 K 69. 1.09 × 10

−23

atm 71. 6.05 × 10

J/K 73. 1094 K 75. a. −802 kJ/mol;

b. −794 kJ; c. The negative value shows that the reaction is sponta-

neous at room temperature, but it says nothing about the rate at

which the reaction proceeds. The additional heat from the spark or

ﬂame is necessary to get the reaction to happen at an appreciable

rate. 77. 2

(g) + 13O

(g) → 8CO

(g) + 10H

O(g); As the

reaction proceeds, 15 mol of gas is converted to 18 mol of gas. The

increase of 3 mol of gas will cause an increase in entropy. 79. To

predict spontaneity, we must calculate if the entropy of the universe

increases. To complete this calculation, we must consider both the

system and the surroundings. In other words, we need to account for

the entire universe. Using Gibb’s equation, we need only consider

variables related to the system. 81. Under these conditions, Q be-

comes an equilibrium constant. 83. a. 4 formed, 2 used = 2 net

ATP; b. 0.055 g; c. The reactants had higher potential energy.

85. At 400°C, every reaction will speed up including those reactions

that cause the decomposition of biochemicals. Many proteins and

other cellular structures are unstable and will decompose (cook!) at

400°C. At 330°C, reactions will slow nearly to a stop because there

will not be enough energy available for reactions to occur even with

the assistance of enzymaticcatalysts. 86. a. 1

(s) +6O

(g) →

(g) + 6H

O(l); There should be an increase of entropy on the

order of a few hundred J/K·mol; b. −2812 kJ; 262 J/K, −2875 kJ;

c. −2548 kJ, 976 J/K, −2827 kJ; d. 4.07 L, the gas is removed via res-

piration; e. −71 kJ; f. 13.8 kJ/mol; g. If there were no glucose directly

available to the organism, it would have to rely on other sources of

energy, such as fructose. Fructose is naturally available in many

fruits and vegetables; it also is a product in the hydrolysis of table

sugar (sucrose).

Chapter 15

P15.1 Rate

=−

[HI]

t

[H

]

t

[I

]

t

P15.2 4.6 × 10

−4

M/s P15.3 Second order with respect to [HI];

second order overall P15.4 8.01 × 10

years; 2.41× 10

years

P15.5 30 days; 60 days; 2.5 × 10

days P15.6 Rate = (2.80 × 10

−1

·s

−1

) [CO]

[Hb]

; second order P15.7 The second-order plot

(inverse concentration versus time) shows a straight line, whereas

the others do not. The reaction is second order. P15.8 The overall

reaction is 2NO(g) + O

(g) n 2NO

(g). The intermediate is NO

(g),

and the rate law for the reaction is rate = k[NO]

]. P15.9 First

and second reactions: 10.1 kJ/mol; ﬁrst and third reactions: 12.6

kJ/mol; second and third reactions: 13.8 kJ/mol. The values vary

slightly as a consequence of small variations in experiments and

mathematical rounding. When more than two data points are avail-

able, the preferred method is graphical (plot ln k versus 1/T), which

gives a value of 12.8 kJ/mol.

1. a. Total distance run = extent of reaction; b. average speed (total

distance over time) = average rate of reaction; c. exact speed the

runner is moving at a particular moment (perhaps using a radar

gun) = instantaneous rate; d. exact speed as the runner started

the race (again, with the radar gun) =initial rate 3. 2.5 ×10

−8

M/s;

Yes, for many reactions, the initial rate of the reaction is fastest and

the rate of the reaction slows as the reaction proceeds. In this case,

the initial (and instantaneous) rate and others near the start of the

reaction would be larger than the average rate. 5. C

is produced

at twice the rate;

Rate

=−

[C

]

t

[C

]

t

7. a. 5 × 10

−4

M/s;

b. 1.3 × 10

−3

M/s; c. 1.2 × 10

−9

M/s; d. 2.0 × 10

−5

M/s

9. a. –6.8 × 10

−2

M/s; b. 2.2 × 10

−2

M/s; c. 4.5 × 10

−2

M/s

11. a. 0 mi/h; b. 112 mi/h; c. 187 mi/h; d. 134 mi/h; e. This plot is the

opposite of most reactions, in which the amount of products is high

at ﬁrst and then levels off as the reaction slows down. Here the dis-

tance covered is lowest initially and is larger as the racer speeds up.

13. a. The rate of appearance of water is twice the rate of appearance

of oxygen.

b. Rate

=−

[H

]

t

[O

]

t

[H

t

15.

17. a. Increasing the temperature will increase the rate of reaction

because that temperature increase (1) increases the number of colli-

sions and (2) increases the speed of the molecules, which increases

the energy in those collisions, making reaction more likely. b. Will

not increase the rate: see part a above. c. Increasing the initial con-

centration of the reactants, will make collisions between those reac-

tants more likely, thereby increasing the rate of the reaction. d. Will

not increase the rate; lowering the concentration of the reactants will

make collisions between those reactants less likely, thereby decreas-

ing the rate of the reaction. 19. a. Third order; b. k is the rate

0 50 100 150 200 250

0.5

1.5

2.5

Time (minutes)

Oxygen

Ozone

Concentration (M)

A40 Answers to Practice Exercises and Selected Exercises

constant of the reaction. c. The reaction rate quadruples. d. no effect

21. 2.01 × 10

−4

M/s 23. Rate laws are experimentally determined,

so there is no way, without additional information, to know what

order the reaction is. Further, we cannot merely look at a reaction to

determine the order of the reaction. 25. a. 3.61 × 10

−4

−1

;

b. 1.32 × 10

−3

/min; c. 5.55 × 10

−10

/year; d. 1.21 × 10

−4

/year

27. a. 43 min; b. 86 min; c. 143 min 29. a. 0.0916 M; b. 0.0839 M;

c. 0.183 M; d. 0.193 M 31. 0.195 M 33. a. [A]

= 0.100 M cannot

be correct because the initial concentration cannot be lower than the

later concentration. b. The time values here are reversed—that is, the

initial time should be lower than the later time. 35. 409 s for [A]

0.0333 M. 37. 0.0141 M/h 39. 8.65 M

−1

·min

−1

41. a. 0.0999 M;

b. 0.499 M; c. 0.327 M; d. 7.82 × 10

−4

M 43. Because collisions be-

tween the reactants must occur for a reaction to take place, and the

number of reactants is decreasing with time, the number of colli-

sions between reactants becomes rarer with time. A slower rate of

collision results in a slower reaction rate. 45. The half-life is con-

stant for a ﬁrst-order reaction and does not depend on the initial

concentration. Pablo’s experimental measurement should be

consistent. The half-life of a second-order reaction is inversely

proportional to the initial concentration. Peter’s experiment will be

different because the initial concentration, and therefore the half-

life, will be different. 47. a. 1.71 × 10

−3

−1

; b. 1.98 M

−1

·h

−1

;

c. 1.49 × 10

−6

M/h 49. 0.594 M 51. 141 years 53. The reaction

is second order. 55. a. rate doubles; b. rate doubles; c. rate

quadruples 57. Rate = (2.2 s

−1

) [B]

, ﬁrst order 59. Rate =

(1.0 × 10

−2

·s

−1

) [A]

[B]

, third order 61. zero order, 0.047

M/min 63. a. ﬁrst-order plot [ln(large dark atoms) versus time];

b. The rate at left is double the rate at right. c. s

−1

65. ﬁrst order;

0.229 min

−1

67. a. Rate =k [Stabilizer]

0.5

]

; b. 3.60 ×

−3

−1.5

·s

−1

; c. 1.20 × 10

−3

M/s; d. 0.360 M 69. 84% (458 cpm)

71. Because each of those values is the y intercept of the graph, each

line would be moved vertically until the intercept was at y = 0.

73. negative 75. 8.95 × 10

−2

−1

77. –1· 79. A reaction mecha-

nism is a collection of single simple steps called elementary steps that

represent what is thought to occur in a reaction. The slowest step in

the mechanism usually determines the rate of the reaction and is

called the rate-determining step. 81. The answers will vary. One ex-

ample: (1) Hear phone ring. (2) Decide to answer. (3) Push chair out

from table. (4) Stand up. (5) Walk to phone. (6) Pick up phone.

(7) Say “Hello,” etc. Depending on how agile you are and how far the

phone is from the table, you might choose step 3, 4, or 5 as the slow

step. 83. 8.84 kJ/mol 85. Mechanism B, with its ﬁrst-step slow

step has a rate law of Rate = k[H

][I

−

], which does not have the

proper hydrogen ion concentration dependence. The rate law for

Mechanism A does match and is derived by setting the rates of the

forward and reverse reactions in the ﬁrst step equal, solving for the

intermediate concentration, and placing that concentration into

the rate law from the second step:

Rate

−1

][H

][I

−

] = k[H

][I

−

][H

]

87. a. 97.9 kJ/mol; b. 2.4 × 10

−3

−1

·s

−1

89. a. A reaction interme-

diate is a compound that is formed and then consumed during the

course of a reaction. b. An activated complex is the species or collec-

tion of atoms that exists at the transition state midway between reac-

tants and products in a single elementary step. c. A homogeneous

catalyst is a species in the same phase as the rest of the reactants and

aids in the reaction by lowering the overall activation energy in the

process of converting reactants to products. A homogeneous catalyst

is destroyed, and then re-created, in the course of the reaction.

d. A heterogeneous catalyst is a species or material in a different

phase from the rest of the reactants; it aids in the reaction by lower-

ing the overall activation energy in the process of converting reac-

tants to products. 91. a. 2N

O n 2N

+ O

; b. O is an intermedi-

ate. There are no catalysts; c. ﬁrst step 93. a. Lactose n glucose +

galactose; b. (Lactase–lactose) and (lactase–glucose–galactose) are

intermediates. Lactase is the catalyst. c. Rate = k[Lactase][Lactose]

95. a. N

(g) + 3H

(g) n 2NH

(g); b. FeH

and FeN

; c. Fe(s);

d. heterogeneous 97. 1.7 × 10

−3

M/s; 0.10 M/h 99. a. 0.350 s

−1

;

b. 1.98 s 101. 200 kJ 103. a. C

(aq) + HCl(aq)





Cl(aq);

b. Rate = k

][HCl] 105. answers vary 107. a. CH

(g) +

(g) n CO

(g) + 2H

O(g); b. low densities, few collisions, low O

concentration 109. See diagram; the uncatalyzed proﬁle is repre-

sented by the solid line. a. exothermic (∆H = –92 kJ); b. sponta-

neous (∆G = –32 kJ); T = 458 K; c. See short-dashed line in

diagram.

d. See long-dashed line in diagram. e. 15 g; f. 12.2 kg

Chapter 16

P16.1 0.224 M P16.2

K =

[

][

]

[

][

]

P16.3 a.

K =

[

][

]

[

][

]

; b.

K =

[

]

[

HCl

][

]

;

K =

[

]

[

][

]

P16.4 a. reactants; b. reactants; c. reactants; d. products

P16.5 1.1 × 10

P16.6 1.5 × 10

P16.7 a. left; b. right; c. right;

d. left P16.8 0.016 M P16.9 [H

] = 1.8 × 10

−5

M,[C

−

] =

0.050 M,[C

] = 0.050 M P16.10 a. shift right; b. shift left;

c. no change; d. shift left P16.11 K = 0.017; The difference be-

tween the two values may lie in the difference between the activities

and concentrations.

1. Even though the concentrations are not changing, the reactants

and products are continuously reacting to form each other, making

the equilibrium dynamic. 3. A reaction that does not go to comple-

tion stops reacting before all of the reactants have been converted to

products. In other words, the reaction reached equilibrium and a

zero Gibbs energy change before all of the reactants were converted.

5. a.

K =

[

]

[

HCl

][

]

; b.

K =

[

][

]

[

][

]

; c.

K =

[

]

[

]

7. a. At equilibrium, the forward and reverse reaction rates are equal.

b. The concentrations are related via the equilibrium expression,

K =

[

CaSO

]

[

]

[

]

. c. At equilibrium, G = 0.

−1

[

HCl

]

[

][

]

= K

11. If equilibria could not be controlled, the amounts of products

could not be maximized for proﬁt. 13. a. blue; b. yellow

15. a.

K =

[

]

; b.

K =

[

]

[

]

17. a. 0.10 (any value slightly smaller than 1); b. [CO] > [CO

]

19. C

(g) + 5O

(g) 



3CO

(g) + 4 H

O(g),

K =

[

]

[

]

[

][

]

Extent of reaction

Energy

Chapter 17 A41

b. PbI

s = 0.0017 M,SrC

s = 0.00022 M; c. Because K

is a

larger number for SrC

, you may have placed the E bar more

toward the products. However, PbI

is actually more soluble.

97. With six sites, EDTA binds strongly, resulting in large K.

98. a. G = –24.8 kJ/mol; spontaneous; b. K = 2.22 × 10

product favored; c. 4.5 × 10

−5

; d. 3.56 × 10

−12

M/s; e. 0.30 M;

f. The methanol concentration will increase. g. $301

Chapter 17

P17.1

P17.2

P17.3 Three possible acids weaker than HF (K

= 7.2 × 10

−4

) are

acetic acid (CH

COOH, K

= 1.8 × 10

−5

), phenol (C

OH, K

1.6 × 10

−10

), and hypobromous acid (HBrO, K

= 2.8 ×10

−9

Three acids that are stronger than HOCl (K

= 2.9 × 10

−8

) are

acetic acid (CH

COOH, K

= 1.8 × 10

−5

), hydroﬂuoric acid (HF,

= 7.2 × 10

−4

), and nitrous acid (HNO

, K

= 4.0 × 10

−4

P17.4 Any of these are correct: hydrogen sulfate ion, chlorous acid,

hydroﬂuoric acid, nitrous acid, and lactic acid. P17.5 Because bro-

mine is more electronegative than sulfur (2.8 vs. 2.5), more electrons

will be pulled away from the hydrogen end of the bond in HBr than in

S. HBr should be a stronger acid than H

S. P17.67.55 ×10

−5

P17.7 a. 2.336; b. 8.558; c. 5.492; d. 1.2 × 10

−4

M; e. 3.2 × 10

−4

f.1.2 × 10

−10

M P17.8 6.14 P17.9 1.65, 0.022 M, 4.5 × 10

−13

P17.10 3.00, 4.602 P17.11 2.92 P17.12 14.025 P17.13 12.23

P17.14 1.46 P17.15 9.07 P17.16 6.10

1. In the Arrhenius model, a base produces OH

−

in solution, which

ammonia does in the reaction NH

+ H

O 



+ OH

−

.In

the Brønsted–Lowry model, a base accepts a proton from another

species (the acid), which NH

does from water in the formation of

in the reaction. 3. a. NO

−

; b. Br

−

; c. OH

−

; d. ClO

−

5. a. H

O; b. NH

; c. H

; d. HF 7. a. 2Al(s) + 6HCl(aq)

→

2AlCl

(aq) + 3H

(g), aluminum chloride; b. Ca(s) + 2HNO

(aq)

→

Ca(NO

)

(aq) + H

(g), calcium nitrate; c. 2Na(s) + 2HCl(aq)

→

2NaCl(aq) + H

(g), sodium chloride; d. 2 K(s) + 2HNO

(aq)

→

2KNO

(aq) + H

(g), potassium nitrate 9. A strong acid is one

that dissociates completely in solution to form H

11. a.

13.

15. a. K

> 1; b. The conjugate base will not regain H

. c. 100%

17. HI; Even though bromine is slightly more electronegative than

iodine, the iodide ion is much larger and has a much more diffuse

electron density than the bromide ion. The attraction of H

for the

larger I

−

with its lower electron density is less, so the HI bond breaks

more easily and HI is the stronger acid. 19. Because both acids

have an equal number of oxygen atoms that contribute to pulling the

Mg(OH)

Base

2HCl

Acid



MgCl

Conj. base

Conj. acid



 Mg(OH)

n MgSO

 2H

Acid Base Conj. base Conj. acid

NaOH  CH

COOH n CH

COONa  H

Base Acid Conj. base Conj. acid

HCl  H

O n Cl



 H



Acid Base Conj. base Conj. acid

(CH

)

COOH (aq)

Acid

O (l)

Base



(CH

)

COO



(aq)

Conjugate Base



(aq)

Conjugate Acid



NCH

(aq)

Base

O (l)

Acid



NCH



(aq)

Conjugate Acid



(aq)

Conjugate Base



21. 0.050 M 23.

K =

[

]

[

]

25. Values of K  1 are product favored; values of K  1 are reac-

tant favored; and values of K near 1 produce mixtures. The ammonia

synthesis produces a mixture, the ozone depletion is product fa-

vored, and the acid ionization is reactant favored. 27. a. In order to

get a quantitative 1:1 reaction between EDTA and the metal, the re-

action needs to go to completion. If the reaction does not go to com-

pletion, we will not have a ﬁrm idea of how much metal is in the

solution. b. A K = 10

ensures complete reaction, whereas a K = 10

produces a mixture.

29. a.

K =

[

]

[

]

[

]

; b. 82.8; c. 0.0121; d. 9.10 31. 11

33. a.

K =

[

]

1/2

[

]

3/2

[

]

; b. 2CH

(g) 



(g ) + 3H

(g);

K =

[

][

]

[

]

; c.

(

)

35. 6.6 × 10

37. Adding the two reactions results in a third reaction with

K = 1.3 × 10

, which is a sufﬁciently large value to ensure the reac-

tion proceeds enough toward the products for the investigators to do

the analysis. 39. K = 0.092, the strategy is not reasonable.

41. 0.76 43. a. 3.0 × 10

−3

M; b. 1.8 × 10

−5

M; c. 4.2 × 10

−4

45. a. forward; b. reverse 47. a. forward; b. no change; c. reverse;

d. reverse 49. 1.05 × 10

−5

M 51. 1.7 × 10

−93

53. a. 7.8 × 10

−6

b. 0.76 M 55. a. H

O n H

+ OH

−

plus the forward and reverse

codeine reaction; b. Only the forward codeine reaction is important;

c. forward; d.



−







4.0 × 10

−4

[

]

= 0.10 M

57. Q < K for the con-

ditions given, so more silver can be extracted.

59. a. 2.72 M;

61. 0.22 M 63. 5.0 × 10

−13

65. [V

] = 0.0115 M,[VO

] = 0.138 M,[H

] = 0.0770 M

67. [MbO

]=1.8 ×10

−12

M,[Mb]=0.00102 M[O

]=0.000020 M

69. a. right; b. left; c. no effect; d. left; e. no effect 71. a. CuCl sys-

tem; b. no effect because solids do not appear in K 73. Because the

reaction shifts toward the blue upon heating, we could assume that

the reaction would shift in the opposite direction upon cooling—

toward the pink. 75. A catalyst affects the speed of a reaction but

does not affect the equilibrium position. 77. a. 1.00; b. 1.00;

c. 0.357; d. 52.2 79. –6.45 kJ/mol 81. 9.69 kJ/mol 83. The

strongest is formic acid; the weakest is acetic acid. 85. The most

important calculation would be the total cost per unit of product

formed. Although Method A uses more expensive reactants, little

would be wasted. With a much smaller equilibrium constant,

Method B will produce less product per given amount of reactant.

Much more reactant will be needed to produce the same amount of

product as Method A, a disadvantage that offsets the lower cost of

the reactants. The exact balance of reactant price versus amount of

product formed will be the deciding factor. 87. 2.6 × 10

−29

89. An equilibrium condition would exist if the total number of

people inside the shop remained the same. There would be the same

number of people entering the shop as ﬁnishing their shopping and

leaving. A larger value of K would indicate a greater number of

people in the shop, which should be more proﬁtable. If Q were less

than K, there would be fewer people in the shop, indicative of a poor

business day. 91.

[

]

[

]

= 24.2atm;

[

]

= 27.8atm

93. 1 min; All frames beginning at 1 min. have the same composition.

95. a.

Reactants Products

A42 Answers to Practice Exercises and Selected Exercises

electrons from the bond to hydrogen, we must consider the

electronegativity of the central halogen atom. Chlorine has a higher

electronegativity than bromine and weakens the bond to hydrogen

more than in HBrO

; therefore, HClO

must be the stronger acid.

21. a. acetic acid; b. formic acid 23. 1.2 × 10

−5

25. a. 2.342;

b. 5.485; c. 8.091 27. a. 3.8 × 10

−5

M, 2.6 × 10

−10

M, 9.58;

b. 2.25, 1.8 × 10

−12

M, 11.75; c. 1.3 × 10

−10

M, 9.89, 4.11;

d. 1.3 × 10

−4

M, 3.9, 7.9 × 10

−11

M 29. The concentration is low-

ered. 31. 12.769 33. a. 4.509; b. 4.538 35. 4.4 × 10

−5

mol of

−

37. a. 0.35; b. 1.35; c. 3.312; d. 3.59 39. a. 3.90; b. 3.17;

c. 2.00; d. 3.47 41. a. 4.426; b. 1.735; c. 7.338 43. 1.6 × 10

−6

45. both (1.03 × 10

−3

M and 0.0010 M) 47. a. 513 g;

b. [F

−

] = [H

] = 1.3 × 10

–2

M,[OH

–

] = 7.7 × 10

–13

49. pH = 3.12; The approximation cannot be used. 51. a. 9.79;

b. 12.00; c. 11.32 53. [OH

−

] = 1.18 × 10

−6

M, pOH = 5.92,

pH = 8.07 55. 7.1 × 10

−4

57. H

+ H

O 



−

+ H

O 



HPO

2−

+ H

; HPO

2−

+ H

O 



3−

+ H

; Phosphorus has an oxidation number of +3 in each

of the species. 59.



HPO

2−



= 6.2 ×10

−8

M; pH = 1.08

61. H

+ H

O 



+ HSO

−

; HSO

−

+ H

O 



2−

63. 10.25 65. In order of decreasing pH: NaC

,NaCl,

Cl. 67. NaY 69. The isoelectric pH is the point where a

chemical (usually an amino acid) is in its zwitterionic form (dual

positive and negative charges) and is electrically neutral. Each amino

acid will have its own isoelectric pH, which enables chemists to sepa-

rate the amino acids electrically in a medium that has a pH

gradient. 71. 5.31 73. a. 2.34 × 10

−10

; b. 1.20 × 10

−6

; c. 1.4 ×

−3

75. 8.22 77. a. NH

+ HCl n NH

Cl; b. acidic because of

; c. 5.06 79. 11.72 81. a. C

COO

−

+ H

O n

COOH + OH

−

= 1.5 × 10

−10

; b. 8.09

83.

85.

87. a. Because water is a neutral molecule, the addition of a positive

proton to the structure results in a +1 charge. b. The hydrogen ion

can associate with more than one unit of water to form H

,etc.c. The Lewis structure of H

has three bonds and one

lone pair on the central oxygen. This molecule would have a tetrahe-

dral electron geometry. Because the lone pair takes one corner of the

tetrahedron, the molecular geometry is a trigonal pyramid.

89. Yes. Even though a strong acid is 100% dissociated, a low enough

concentration of the acid could be made to match the acidity of a

concentrated weak acid solution. 91. Acetic acid is a stronger acid

than water and therefore makes a weaker base than water. The strong

acids will have a more difﬁcult time dissociating in an acetic acid so-

lution so that the differences in the strong acids can be detected by

their varying dissociation in acetic acid. 93. The larger positive

charge left behind, along with the reduced pull of the electronegative

atoms due to the extra electrons left from the ﬁrst ionization, limits

the extent of the second ionization. 95. a. Ephedrine alkaloids act

as a stimulant, as does caffeine. The combination of two stimulants

greatly increases the chance of undesired side effects, including death.

b. The ephedrine structure:

c. Yes. Alkaloids are natural nitrogen-containing molecules.

The nitrogen in the structure is an amine that has basic (alkaline)

C NH



COO



properties; hence the name alkaloid. 97. The range of low pH pre-

cipitation has decreased; a reduction in SO

and NO

pollutants

would decrease acid rain and increase pH levels. 98. a. Basic;

b. KC

(s) n K

(aq) + C

−

(aq) followed by

−

+ H

O 



+ OH

−

; c. 8.38; d. 96.9 g;

e. 10.63; The pH of the solution is much higher because of the

presence of the ammonia.

Chapter 18

P18.1 8.88 P18.2 acidic, 3.87 P18.3 8.2 g P18.4 37 mL

P18.5 4.44 P18.6 9.61, 8.59 P18.7 34 mL P18.8 a. (0 mL,

0.6021); b. (10.00 mL, 0.9700); c. (20.00 mL, 1.5563); d. (25.00 mL,

7.000); e. (30.00 mL, 12.3565); f. (40.00 mL, 12.7611)

P18.9 a. (0 mL, 2.67); b. (5.00 mL, 4.14); c. (12.50 mL, 4.74);

d. (24.00 mL, 6.12); e. (25.00 mL, 8.92); f. (40.00 mL, 12.7611)

P18.10 bromothymol blue P18.11 1.82 × 10

−2

mol/L

P18.12 4.6 × 10

−6

P18.13 Yes, Q

= 2.71 × 10

−14

> K

P18.14 6 × 10

−5

P18.15 7.945 mL

1. a. NH

+ H

O 



+ OH

−

;2H

O 



+ OH

−

;

b. Fe(OH)





+ 3OH

−

;Fe

+ 6H

O 



Fe(H

;

Fe(H

+ H

O 



Fe(H

(OH)

+ H

;2H

O 



+ OH

−

; c. HCOO

−

+ H

O 



HCOOH + OH

−

;2H

O 



+ OH

−

3. a. yes; b. no; c. no; d. no; e. yes 5. a. 9.25;

b. 8.30; c. 4.22 7. a. raises pH; b. lower pH; c. no effect 9. a. 10;

b. 1.0; c. 0.10 11. a. 62 mL; b. 6.7 mL; c. 106 mL 13. a. 9.25;

b. 4.74; c. 3.74 15. The ﬁnal pH of a buffer is determined by the

of the acid that sets the center of the possible range of pH for the

buffer, whereas the exact ratio of the concentration of a conjugate

base to its acid determines how far away the ﬁnal pH is from the pK

of the acid.

17. a.

][ClCH

COO

−

]

[ClCH

COOH]

and

[OH

−

][ClCH

COOH]

[ClCH

COO

−

]

;

0 1020304050

Volume NaOH (mL)

Titration Curve

0 1020304050

Volume NaOH (mL)

Titration Curve

Chapter 19 A43

b. 2.91 19.The two methods yield the same value: 10.34. 21. a. 9.26;

b. 9.86; c. 10.43; d. 8.08 23. 0.64 25. a. 2.56; b. The buffer would

be more resistant in the basic direction because there is more acid to

react with added base. 27. 3.73 29. 4.88 31. a. 0.069 L; b. 0.11 L;

c. 0.053 L; d. 0.011 L 33. a. 13.137; b. 12.99; c. 12.71; d. 7.00; e. 1.231

35. a. 11.13; b. 9.74; c. 9.26; d. 5.25; e. 1.903 37. a. 13.398;

b. 13.342; c. 12.859; d. 11.59; e. 7.00; f. 2.53; g. 1.777

39. a. methyl orange or methyl red; b. phenolphthalein; c. bro-

mthymol blue 41. a. colorless; b. green; c. red; d. blue 43. a. 8.69;

b. 0.060 M; c. 0.36% 45. a. 8.85; b. 0.22; c. No, the endpoint will be

at pH = 7.00, but the midpoint of color change will not occur until

pH = 8.85. 47. a.

AgI(s) 



(aq) +I

−

(aq);K

= [Ag

][I

−

]

;

b. Ag

CrO

(s) 



2Ag

(aq) + CrO

2−

(aq);

= [Ag

]

[CrO

2−

]

;

c. Al

(s) 



2Al

(aq) + 3S

2−

(aq);

= [Al

]

2−

]

;

d. Ca

(PO

)

(s) 



3Ca

(aq) + 2PO

3−

(aq);

= [Ca

]

[PO

3−

]

49. a. 9.2 × 10

−23

mol/L; b. 1.6 × 10

−5

mol/L; c. 4.6 × 10

−6

mol/L

51. a. 3.0 × 10

−21

; b. 2.0 × 10

−16

; c. 3.2 × 10

−11

53. BaF

55. a. A solid forms; b. A solid forms. 57. Acid reacts with

iron (III) hydroxide, increasing its solubility. Additional base lowers

the solubility because of to the excess hydroxide ion in solution.

59.

= [Ca

][F

−

]

, 4.3 × 10

−4

mol/L 61. Ca(IO

)

; Acidic so-

lutions enhance the solubility by reacting with the anions, which are

weak bases. 63. a. Ag

(aq) +NH

(aq) 



Ag(NH

)

; Ag(NH

)

(aq) 



Ag(NH

)

; b. Ni

(aq) + NH

(aq) 



Ni(NH

)

(aq); Ni(NH

)

(aq) + NH

(aq) 



Ni(NH

)

(aq);

Ni(NH

)

(aq) + NH

(aq) 



Ni(NH

)

(aq); Ni(NH

)

(aq) +

(aq) 



Ni(NH

)

(aq); Ni(NH

)

(aq) + NH

(aq) 



Ni(NH

)

(aq); Ni(NH

)

(aq) + NH

(aq) 



Ni(NH

)

(aq)

65. a. 962 mL; b. 2370 mL; c. 64 mL 67. 1.5 × 10

−11

69. a. Because the K

value for Cu(OH)

is low (1.6 × 10

−19

), the

formation constant must be quite large to overcome the low solubil-

ity of the salt; b. Cu

(aq) + NH

(aq) 



Cu(NH

)

(aq);

Cu(NH

)

(aq) + NH

(aq) 



Cu(NH

)

(aq); Cu(NH

)

(aq) +

(aq) 



Cu(NH

)

(aq); Cu(NH

)

(aq) +NH

(aq) 



Cu(NH

)

(aq) 71. lead–EDTA 73. blood chemistry,

EDTA titrations of certain metals, growth of certain bacteria in

a lab culture, and so on. 75. a. H

−

and HPO

2−

;

[HPO

2−

]/[H

−

] = 9.8

77. a. The zinc and cobalt ions are

smaller than calcium, preventing strong coordination with all six

EDTA binding sites. b. The higher charge of Fe

interacts more

strongly with the –4 charge on EDTA. 79. a. 0.00050 M;

b. 2.5 × 10

−5

mol 81. a. 9.5 × 10

−15

M; b. no 83. For a 0.1 pH

change, 106 mL H

O could be added. 85. a. Cl

−

,Ag

+ Cl

−

AgCl(s); b. AgNO

would change NO

−

concentration. Silver acetate

= 1.9 × 10

−3

) may work. 86. a. 2.6 × 10

−4

; b. (0 mL, 2.46);

(10.0 mL, 2.97); (25.6 mL, 3.58); (50.0 mL, 5.20); (75.0 mL, 12.134);

(100.0 mL, 12.387); c. thymol blue; d. 24.0 g/mol

0204060

Volume HNO

(mL)

Titration Curve (KOH by HNO

)

Answer 82b.

Chapter 19

P19.1 In C

:H(+1), O(−2), C(0); In CO: O(−2), C(+2)

P19.2 Li

S < S

< SO

< H

P19.3 −359 kJ, spontaneous

P19.4 2H

(aq) + ClO

−

(aq) + Cu(s) n Cl

−

(aq) + H

O(l)

+ Cu

(aq) P19.5 2MnO

−

(aq) + 3Mn

(aq) + 4OH

−

(aq) n

5MnO

(s) + 2H

O(l) P19.6 −0.25 V, +0.98 V

P19.7 The galvanic cell (above top) has a potential of 0.98 V, the

electrolytic cell (above bottom) has a potential of −0.25 V.

P19.8 Al(s) | Al

(aq) || Fe

(aq) | Fe(s) P19.9 Ca > Na > Al > Cu

P19.10 −0.0592 V, cathode, no P19.11 1.45

P19.12 1.5 g

1. A battery is a series of cells, most “batteries” are single cells.

3. The two reactions are a reduction reaction that involves the gain

of electrons and an oxidation reaction that involves the loss of

electrons. 5. O (−2), H (+1), S (−2), C (−1) 7. NaClO

,HCl

9. NH

< N

O < NO < NO

11. a. K (+1), O (−2),

Mn (+7); b. Li (+1), O (−2), Mn (+3); c. H (+1), O (−2), N (−3),

Cl (+7) 13. a. is reduced, is an oxidizing agent; b. is oxidized, is a

reducing agent; c. is reduced, is an oxidizing agent 15. Reactants:

Mg (0), H (+1), P (+5), O (−2); Products: Mg (+2), P (+5), O (−2),

H (0) 17. a. +1; b. If ClO

−

is a good oxidizing agent, it must be

Anode

Cathode

Salt bridge

electrode

Anode

Cathode

Salt bridge

electrode

Gas electrode

(CH

and CO)

Gas electrode

(SHE)

0 50 100 150

Volume NaOH (mL)

Titration Curve (HA by NaOH)

A44 Answers to Practice Exercises and Selected Exercises

itself reduced which is a gain of electrons. 19. a. Reactants: Sr (+2),

Cl (−1), Products: Sr (0), Cl (0); b. Sr

21. a. reduction: 1st reaction;

oxidation: 2nd and 4th reactions; b. precipitation; c. 4Fe(s) +3O

(aq) +

O(l) n 4FeO(OH)(s) 23. concentrations = 1M, pressures =

1 atm 25. a. non-spontaneous; b. negative; c. negative, positive;

d. negative 27. 2Fe

+Fe n 3Fe

, E°

cell

=+1.2 V 29. −228 kJ

31. −216 kJ 33. The redox atoms must be balanced, the non-redox

atoms must be balanced, and the electrons (used to balance the

charges) involved in the oxidation and reduction half-reactions must

cancel. 35. a. 2CO

+ 2H

+ 2e

−

n H

,reduction,CO

reduced; b. Np

+ 2H

O n NpO

+ 4H

+ e

−

, oxidation, Np

oxidized. 37. a. Sn

+ 2Cu

n Sn

+ 2Cu

;

b. I

−

+ 2S

2−

n S

2−

+ 3I

−

; c. Fe

+ SO

−

+ H

O n

2−

+ Fe

+ 2H

39. acidic: Cr

2−

+ 14H

+ 3Cu n

3Cu

+ 2Cr

+ 7H

O; basic: Cr

2−

+ 7H

O + 3Cu n

3Cu

+ 2Cr

+ 14OH

−

41. ClO

−

+ I

−

n IO

−

+ ClO

−

43. a. −0.76 V; b. 1.5 × 10

kJ; c. −0.76 V 45. a. Li

; b. F

; c. Zn +

n Cu + Zn

, E°

cell

= 1.10 V 47. 2CO

+ Cu + H

O n

CuO +2H

+ C

2−

49. 2MnO

−

+ 16H

+ 5C

2−

10CO

+ 2Mn

+ 8H

O 51. I

+ C

n C

+ 2I

−

53. A cell is an electrochemical device consisting of an

anode and cathode allowing for the exchange between chemical and

electrical energy. A half reaction is the equation that describes the

reduction or oxidation part of a redox reaction. A galvanic cell is a

cell that produces electricity from a chemical reaction (also known

as a voltaic cell). The electromotive force is a measure of how strongly

a species pulls electrons towards itself in an redox process.

55. Zn, Cu

57. The reduction potentials for lead ion and silver

ion are −0.13 V and 0.80 V respectively. For a spontaneous reaction,

the silver ion reaction will remain as a reduction and lead will be oxi-

dized. If the nitrate ions are moving left to right through the salt

bridge, the electrons are moving from the right cell to the left cell,

which is the opposite of the standard convention. This requires that

the left beaker be the cathode (gaining electrons) and the right

beaker be the anode (losing electrons). Therefore, the oxidation of

lead will occur in the right beaker and reduction of silver in the

left beaker.

59. a. 0.70 V; b. 3; c. shown above; d. Au

; e. Ag | Ag

|| Au

| Au

61. Zn(s) | ZnO(s) || HgO(s) | Hg(l) 63. a. Ba; b. Pb

; c. left

65. Placing the metal in the solution will reveal its identity. Only the

oxidation potential of aluminum in nickel is positive enough to be

spontaneous when coupled with the reduction of nickel. The tin will

not react.

67.

(8.3145 J/mol·K)(298.15 K)



96485 C/mol ×

1J/V



= 0.0257 V

Natural

logarithms and base 10 logarithms are related by

ln x = 2.303 log x

so we must multiply the value of 0.0257 V by 2.303 to give 0.0592 V.

69. a. 0.78 V; b. 0.75 V; c. 0.81 V 71.

G = 0

, the battery has

reached equilibrium, and E

cell

= 0 V 73. a. 0.051 g; b. 12.0 g;

Anode

Cathode

Salt bridge

electrode

c. 44 g 75. cathode, 0.33 A 77. 15.5 g 79. The steel pan is the

cathode, copper metal can serve as the anode. 81. a. E° = 0.97 V,

K = 3.98

196

; b. 4FeO

2−

+ 10H

O n 20OH

−

+ 4Fe

+ 3O

;

c. 0.76 V; d. At high pH, Fe(OH)

forms. This solid removes Fe

from the water and forces the reaction to completion. 83. G

changes as T changes, thus every E value would be adjusted accord-

ingly. 85. 0.21 g CrO

87. a.

b. Zn n Zn

+ 2e

−

; c. 0.32 V; d. 0.32 V, 0.32 V; e. No. Because the

concentrations are equal, the ln term goes to zero and the tempera-

ture has no effect. f. Avoids use of toxic metals like lead. g. Both Zn

and Fe corrode in water.

Chapter 20

P20.1 a. [FeCl

]

4−

; b. [Ni(NH

)

]

; c. [Zn(H

]

P20.2 a. 6, octahedral; b. 6, octahedral; c. 4, tetrahedral; d. 4, tetrahe-

dral P20.3 a. tetraamminedichlorochromium(IV) sulfate;

b. sodium tetracyanonickelate(II); c. Ca

[FeF

];

d. [Mn(NH

)

(CO)

]SO

P20.4 none unpaired

1. a. A ligand is a Lewis base that donates a lone pair of electrons to a

metal center to form a coordinate covalent bond; b. A coordinate

covalent bond is a covalent bond that results when one atom donates

both electrons needed to form the bond; c. A Lewis acid accepts a

pair of electrons from another atom in the formation of a coordinate

covalent bond. 3. a. 6, +2, 6; b. 6, +2, 6; c. 4, +2, 4; d. 4, 0, 4

7. ;NH

is a Lewis base because it is capable of

donating the electron pair to form a bond.

9. Yes; bidentate 11. Ca

and C

have no lone pairs and would

not act as ligands. 13. The structure of ethylenediammine is

. Both NH

groups will have a lone pair and be

able to act as a Lewis base. The carbon backbone is long enough to

allow both nitrogen atoms to form a bond with the same metal

atom. While N

does have two lone pairs, they are found at opposite

ends of a linear molecule. It is not possible for both nitrogen atoms

to form separate bonds with the same metal atom. 15. B is biden-

tate 17. a. +4, 6; b. +2, 6; c. +2, 4 19. Some of the ligands are

bidentate; there can be more bonds than ligands. 21. 4

Anode

–

Cathode

Salt bridge

electrode

Chapter 20 A45

23. a.

octahedral, all 90°;

tetrahedral, all 109.5°;

tetrahedral, all 109.5°

25. +3, 6, octahedral 27. 4, tetrahedral or square planar

29. a. geometric; b. ionization; c. coordination sphere

31.

If the platinum is placed at the center of a hypothetical tetrahedron,

each ligand would reside at one of the vertices. Because each vertex is

directly connected to the other three (containing one ligand like it-

self and two that are different), it is not possible to create more than

one unique arrangement. There can be no isomers.

33. Only two:

4

trans

cis

2

35.

37. a. amminecyanobis(ethylenediamine) cobalt (III);

b. diamminedioxalatochromate(III); c. hexanitroferrate(III);

d. triaquatrichlorocobalt(III)

39. a. [CoCl(NH

)

O)]

; b. trans-[Cu(H

(en)

]Cl

;

c. Na

[CoCl

]; d. [MnCl(CO)

] 41. Tetraamminediaquachro-

mium(III) nitrate, [Cr(NH

)

](NO

)

43. a. [Ar]3d

;

b. [Ar]3d

; c. [Ar]3d

45. Fe

47. a. Fe

is d

: b. Co

is d

c. Ni

is d

49. a. Fe

is d

: b. Co

is d

c. Ni

is d

51. a. tetrahedral high spin Fe



A46 Answers to Practice Exercises and Selected Exercises

b. octahedral low spin Co

)

c. octahedral low spin Mn

)

53. all 55. M(CN)

2−

57. No, The chemical species that form the

majority of the common gemstones is the same for most stones and

will have the same spectrum. 59. a. yellow and red; b. 3; c. higher;

According to the electrochemical series, ammine ligands cause larger

splits in the d orbitals than does water; therefore, the ammine com-

plex should absorb higher energy visible light; d. NH

61. Replac-

ing two ligands with a single chelating ligand frees more species into

solution, raising the entropy. 63. Labile; labile 65. Nearly all

transition metals have important catalytic properties. 67. Cation;

[Co(NH

)

]

is +1 because the total charges are (+3) +4

(0) + 2

(−1) =+1. 69. a. If there are some electrons in the d-

orbitals of the metal center in a complex, but not enough electrons

to fully ﬁll the orbitals, electronic transitions are possible. Any con-

ﬁguration from d

to d

will be able to have its electrons promoted

by light absorption; b. The energy of the photon being absorbed is

determined by the splitting between the d-orbital levels, which is

controlled by the ligands of the complex. The splitting increases in

order with the spectrochemical series: Cl

−

< F

−

< OH

−

< H

O <

< NO

−

< CN

−

< CO; c. The intensity of the transition will in-

crease with greater population in the lower states and lower popula-

tion in the higher states. 71. Larger K

72. a. b.

c. Since the ammine complex has a violet color and the ethanedithiol

complex is blue, the absorbed colors are green and yellow respec-

tively. Green light lies at a higher energy than yellow; therefore the

splitting caused by the ethanedithiol is less than that caused by am-

mine. The new ligand will fall before NH

in the spectrochemical se-

ries; d. 4; e. The ligand is inert.

Chapter 21

P21.1 a. 16, 16; b. 11, 12; c. 86, 136; d. 43, 55 P21.2

→

−1

 +

P21.3

218

Po →

He +

214

Pb +



230

Th →

He +

226

Ra +



P21.4 17.8 days P21.5 5.588

kJ/mol P21.6 a. Stable; b. Stable; c. Stable; d. Stable or unsta-

ble: The numbers of protons and neutrons are odd, which argues for

instability, but the mass is very close to the average periodic table

mass, which argues for stability. It is in fact stable.

P21.7

P21.8 The ﬁrst and third structures are not suitable. This ﬁrst has a

radioactive tritium that is easily removed as an acidic hydrogen ion,

and the third is not structurally the same as salicylic acid.

for both 3. Yes, an atom can have no neutrons. Hydrogen,

has no neutrons—only a proton is required. 5. Yes,

He has

a smaller mass than

H. 7. a. 7, 5, 7; b. 51, 73, 51; c. 63, 89, 63;

d. 4, 5, 4 9. 0.014 g 11. a. Sr

; b. Its chemical behavior is similar

to that of calcium. 13. Gamma rays have more energy per photon.

15. a.

239

→

235



; b.

→

−1

 +

N; c.

137

→

−1

 +

137

17. a.

219

→

215



; b.

→

−1

 +

Y; c.

→

−1

 +



19.

146

→

142

Nd 21. Th-232 23. Ionizing: cosmic rays, gamma rays, X-

rays; Nonionizing: visible light, microwaves, IR radiation 25. Use

minimum gamma doses, wear protective clothing, apply the dose

while in a different room. 27. a. They differ only in the amount of

disintegrations, (1 curie = 3.7 × 10

Bq); b. A rem is the biologically

adjusted version of rad. 29. 3.5

disintegrations/s

31. a. 0.40 mrem; b. This radiation is not unduly hazardous.

33. a. Density; b. chemical reactivity, radiation hardness (does it

weaken with exposure?), secondary radiation reactivity 35. a. A;

b. 10 min; c. A; d. A 37. 15 days 39. 50%, 25% 41. 86.7 yr

43. 0.45 days 45. The sample would need to be replaced every

other year (assuming that 5% of the original activity is still useful.)

47. 1.6

yr; It is continuously generated by the decay of other

long-lived radioactive nuclei. 49. a. Some of the mass is lost as

energy in the process of creating the nucleus; b. Yes. 51. The bind-

ing energy,



E, is related to the mass defect,



m,via

E =|m|c

53. –0.006627 g/mol; 5.956

kJ/mol 55. a. reactants b. The re-

sult is the release of energy and creation of binding energy of the

products. 57. Both processes involve the conversion between a

neutron and proton. However, the beta-minus decay converts a neu-

tron into proton, whereas the beta-plus decay converts a proton into

a neutron. 59. a. “Doubly magic” means that a nuclide has both a

number of protons and a number of neutrons that are among the

most stable numbers (2, 8, 20, 28, 50, 82, and 114); b. Oxygen-16 has

8 each of protons and neutrons, and 8 is one of the magic numbers.

Helium-4 has 2 each of protons and neutrons, matching the magic

number of 2. Carbon-12 has 6 each, and nitrogen-14 has 7 each.

These two nuclides do not have a magic number of either protons or

neutrons. In general, those nuclei without a magic number of

protons or neutrons are more likely to be radioactive. 61. Element

114 would have a magic number of protons and would probably be

more stable and have a longer half-life before decaying. 63. In

order to reach the nearest stable nuclide, the heavy radioactive nu-

clides such as uranium and plutonium need to shed at lot of mass

and can do so by emitting alpha particles. For nuclides of lighter

elements, there are stable nuclides that can be created by converting

protons and neutrons by beta decay and need not lose mass to

achieve stability. 65. Iron and cobalt have the most stable nuclei of

all atoms, with the largest binding energy per nucleon.

67. a.

235

→

139

+ 3

energy;

235

→

153

+ 3

energy 69. a. The number

of neutrons differs; b. U-235 is 0.72% and U-238 is 99.28% of the

total. c. They are alike chemically and differ by only 1.3% in their

Absorbed

Chapter 22 A47

total mass, which makes them difﬁcult to separate using physical

methods. 71. Fission creates smaller nuclei. Americium, cali-

fornium, and berkelium are all heavier than uranium. 73. Some of

the most important questions should be about the total radioactive

dose expected, as well as the form of the radiation emitted. What

is the half-life of the nuclide, and what is its expected persistence

in the body? 75. Tc-99m has a half-life of 6 hours. After the

night (12 hours) is over, only 1/4 of the original will remain.

77.

→

 +

O 79. Yes, with a half-life of 60 hours, only

0.8% remains after 2.5 weeks. 81. The medical reference to see is

Winters. T. H., & Franza, J. R., Radioactivity in Cigarette Smoke, New

England Journal of Medicine, 1982; 306(6): 364–365. The radioactive

isotopes lead-210 and polonium-210 are found in the tobacco leaves

and cigarettes. 83. The gamma ray represents the energy that is

given off in the reaction, which is possible only if a mass defect

exists. 85. alpha, beta, beta, alpha, alpha, alpha, alpha, beta, beta,

alpha 87. Rn is radon, an inert gas; and Ra is Radium, a reactive

metal solid. 89. The main reason why Rn-222 is the most danger-

ous is that it is the only species with a long half-life. The other iso-

topes decay much more rapidly into solid species. Rn-222 has a half-

life of 3.8 days, which is enough time for the gas to seep into houses

and be inhaled by people inside. 91. The density of the nucleus is

much greater: 2.8

g/cm

compared to 11.3 g/cm

for lead.

93. Websites may vary. The answer is NO! 95. A nice site with

clickable names and more information can be found at

http://www.slac.stanford.edu/library/nobel/. 97. a. 0.0465 yr;

b. p

= 46, n =57, e

−

= 44; c. 114.4 g 98. a. <0.2 mg; b. Am-240

undergoes electron capture with a half-life of 51 hours. Not only

does it not emit a particle, but nearly all would be gone very

quickly—not a useful property for a smoke detector, which should

last several years. Am-242 does emit beta particles 83% of

the time, but it has a half-life of only 16 hours. Again, there would

be little left in a very short time, making it also impractical for use in

a smoke detector; c.

241

→

237



; d. 2900 yr;

242

→

−1

 +

242



242

−1

 →+

242



Chapter 22

P22.1 Adenine P22.2 The sequence that pairs with our strand

is GATACG, or we need to reverse the smaller strand (CGTATC),

which would then bind with a sequence of GCATAG in the longer

strand:

AAAATGCTGGCATAGCGTTCCAGATACGGACTGACTGC ....

CGTATC CTATGC

P22.3 Methionine–tryptophan–proline–lysine–leucine–aspartic

acid–methionine–phenylalanine–aspartic acid P22.4 Lyase, trans-

ferase, ligase

1. DNA is a huge nucleotide polymer that has a double-helical

structure. Each strand of the DNA polymer complements the other

by forming base pairs. DNA provides instructions for the synthesis

of proteins and enzymes that carry out the biological activities of the

cell. 3. TAATTTTTCCCTGAT 5. Four 7. Valine and leucine or

glycine and alanine

11. A codon is a three-nucleic-acid sequence on an mRNA that is

translated into a particular amino acid during protein synthesis.

13. If the wrong nucleotide is used in the production of the mRNA

or an extra nucleotide is added to or removed from the mRNA, a dif-

ferent three-nucleotide codon may result that could specify a differ-

ent amino acid. 15. Middle 17. Globular 19. Oxidoreductase

21. By binding to the enzyme and inhibiting further production, the

product itself can ensure that its concentration does not rise too high

or ensure that it is created only as needed. 23. Tetrose 25. Aldose

27. Glucose 29. Fructose is one of the two sugars that results from

the hydrolysis of sucrose.Fructose is classiﬁed as a hexose,and ketose.

31. At room temperature, fats are solids and oils are liquids. 33. Fat

35. The upper polar region

37.

39. Because the body uses principally a single type of enantiomer,

having chiral enzymes ensures that only the proper enantiomer is

used in a protein or other product. The cell will not waste resources

on a molecule it cannot use. 41. Tryptophan, no 43. RNA:

AUG|UCG|CGA|AUU|UAA|GGC|UGC|UUA|UU; Protein:

methionine-serine–arginine–isoleucine 45. Each of the molecules

is saturated. As the chain length increases, the strength of the

dispersion forces increases, requiring more energy and higher tem-

peratures to melt. The longer chains therefore have higher melting

points. 47. If the receptors that are responsible for detecting the

sweetness of a food are sensitive only to a particular enantiomeric

form, the other enantiomer is not sensed as sweet. However, if the

receptors are not speciﬁcally sensitive to only the normal enan-

tiomeric form, the other form could also taste sweet. The advantage

to being able to taste the opposite enantiomer is that it may not be

able to be metabolized—it would have no calories!

COOH

Phenylalanine

COOH

HOH

COOH

Serine