Kelter P., Mosher M., Scott A. Chemistry. The Practical Science

Подождите немного. Документ загружается.

steroid hormones such as estrogen. Cholesterol has a bad reputation because of the

link between excessive blood cholesterol levels and cardiovascular disease, but it

is an essential component of cell membranes. Like almost every chemical associ-

ated with life, cholesterol is “good” in the right amounts and right places but

“bad” in the wrong amounts and wrong places.

22.8 The Maelstrom of Metabolism

Chemists have a rather simple chart to look at on their walls; we call it the peri-

odic table. Biochemists have a much more complex chart to admire. The bio-

chemical pathways chart shown in Figure 22.30 is so complex that, even devoting

a full book page to it, we struggle to make out the details. The most commonly

used version is more than 1 square meter in size, and even at that scale it still looks

dense and complex. The biochemical pathways chart summarizes the major se-

quences of chemical reactions of life, each particular sequence being called a

biochemical pathway. The individual pathways are interconnected at various

points, offering yet another example of glorious complexity. The chemical reac-

tions enable the atoms needed for life to ﬂow through all the different molecules

and ions found in living things. The entire network of chemical reactions

involved in life is called

metabolism, and the individual chemicals are called

metabolites.

Each arrow on the biochemical pathways chart represents a chemical reaction

catalyzed by a speciﬁc enzyme. Looking at the chart, we can really begin to ap-

preciate the true complexity of life, the reasons why we need around 20,000 to

30,000 genes (always remembering that many genes code for proteins other than

enzymes), and the breathtaking achievement of the chemistry within each living

thing. We can also appreciate the other breathtaking achievement: that in a little

over 50 years, scientists have been able to sort this all out!

Breaking Things Down

and Building Them Up Again

The food we eat is a mixture of water, carbohydrate, protein, lipids, vitamins, and

minerals. It provides us with chemical raw materials needed to build the chemi-

cals of our bodies, and it also acts a source of energy. To release the energy, and

also to use much of our food as raw materials, our bodies must break the chemi-

cals in the food down into simpler forms. This aspect of metabolism is called

catabolism. Building the raw materials back up into our own carbohydrates, pro-

teins, lipids, and other essential chemicals is the aspect of metabolism called

anabolism.

958 Chapter 22 The Chemistry of Life

Cholesterol

22.8 The Maelstrom of Metabolism 959

FIGURE 22.30

The biochemical pathways chart.

Biochemical Pathways

Thalidomide bottle from 1961.

FIGURE 22.32

Thalidomide is a chiral molecule.

22.9 Biochemistry and Chirality

There is a crucial aspect of the chemistry of life that we have not even mentioned

yet, and it is also an important aspect of the structure of many chemicals not nec-

essarily involved in living systems. Many of the molecules in our bodies are chiral,

a term we introduced in Chapter 12 (Section 12.14). For instance, the mirror

image forms of the general structure of an amino acid are shown in Figure 22.31.

These forms will be nonsuperimposable, provided that the R group is not a hy-

drogen atom. All amino acids except glycine are chiral, and the nonsuperimpos-

able forms of molecules such as this are known as

enantiomers.

Chirality is found in the body in a wide range of molecules, including amino

acids, proteins, carbohydrates, and even DNA and RNA. The amino acids in pro-

teins have, almost exclusively, the same handedness. That is, our bodies have

evolved to utilize only one of the two enantiomers possible in the amino acids.

The same is true for most of the carbohydrates in living things.

The carbohydrates of life are similarly almost exclusive in their

same handedness. Why is this so? This is another of the won-

derful mysteries of life.

Why is chirality in chemicals important? Because it controls

the way in which molecules interact. For example, the binding

sites of enzymes are constructed from the chiral amino acids

within protein molecules. Therefore, enzymes themselves are chi-

ral. They will interact differently with the different enantiomers

of the substrates to which they bind. In many cases, one enan-

tiomer of the substrate will be able to bind to the protein,

whereas the other will not ﬁt into the active site. These distinc-

tions can be highly signiﬁcant.

From 1958 to 1962, large numbers of pregnant women in

many countries began to take a drug called thalidomide, shown

in Figure 22.32. This drug was prescribed in an effort to control

the “morning sickness” that often accompanies the early stages

of pregnancy. The large batches of thalidomide prepared on an

industrial scale for distribution around the world contained

both enantiomers. One of these was very effective in controlling

morning sickness. Unfortunately, the other enantiomer caused a range of pro-

found abnormalities in the developing fetus. Babies born to mothers who had

taken thalidomide were badly deformed. These dangers became evident before

thalidomide received approval for use in the United States, which was therefore

fortunate enough never to experience the tragic wave of “thalidomide babies”

that occurred in other countries.

960 Chapter 22 The Chemistry of Life

The two isomers of glucose (D-glucose

and

L-glucose). D-Glucose is the enan-

tiomer that our bodies use for fuel.

COOH

HHO

CHO

OHH

CHO

D-Glucose

HO OH

HOH

L-Glucose

HO OH

Application

FIGURE 22.31

Mirror images of an amino acid.

22.10 A Look to the Future 961

Thalidomide has since been found to be useful in treating some aspects of

various diseases, including leprosy, rheumatoid arthritis, AIDS, and some can-

cers, especially those related to blood marrow. It remains in use in carefully con-

trolled circumstances, but never for the treatment of women who are, or ever may

become, pregnant. Recently, a compound with a structure that is very similar to

that of thalidomide has been identiﬁed as a potential treatment for myelodys-

plastic syndrome, a malignant disorder that affects blood cell production. The

company manufacturing the drug is seeking approval from the U.S. Food and

Drug Administration to market the compound under the name Revlimid. Initial

studies have indicated that Revlimid has fewer of the harmful side effects caused

by thalidomide, and its use could be beneﬁcial to patients afﬂicted with the ma-

lignant blood disorder.

Many scientists were perplexed at why the safe enantiomer of thalidomide

was not prepared and used in its pure form. Preparations of the safe enantiomer

can indeed be made, but over time, the pure enantiomers spontaneously convert

into a mixture of the two enantiomers, until an interconverting 50/50 mixture of

both forms, known as a

racemic mixture, is obtained. Unfortunately, the process

racemization occurs with many chiral molecules.

22.10 A Look to the Future

Talking about thalidomide reminds us that one major reason behind our interest

in the chemistry of life is the desire to prevent and treat the diseases and discom-

forts that can afﬂict us. Why do we get ill and what can chemistry do about it? The

major causes of illness and disease are

■

Infection—occurs when our bodies become home to harmful microorganisms

■

Abnormal growth of tissues—such as cancerous tumors and less damaging

“benign” tumors

■

Abnormal production of important biochemicals—such as hormones and the

neurotransmitters that make it possible for signals to pass between nerves

■

Genetic diseases—associated with one or more abnormal genes or larger ab-

normalities in genetic material

■

Aging—the degeneration of maintenance and repair functions within the

body

Every doctor’s shelf carries a large volume called a pharmacopeia (see Sec-

tion 18.1), a book that lists the drugs available to ﬁght all manner of diseases and

includes instructions on dosage, uses, and possible adverse reactions. However,

many of these drugs have limited use, exhibit lessening effectiveness, or are sim-

ply ineffective at treating or curing diseases and maladies that affect humans. The

future of useful therapeutic agents relies on the preparation and implementation

of alternatives to these exisiting drugs. Some of the important current advances

in this area are noted here.

Antibiotics

Most of us are treated with antibiotics several times in our lives. These are chem-

icals that can inhibit the growth of microorganisms or even destroy them. The

ﬁrst antibiotic that was isolated and used on patients was penicillin (Fig-

ure 22.33). This compound inhibits the synthesis of bacterial cell walls by selec-

tively binding to enzymes needed for such synthesis. Nowadays we have a vast

armory of antibiotics that work in different ways, but very often by binding to

and inhibiting speciﬁc enzymes. For example, the tetracycline antibiotics are all

Application

Cl Cl

Mechlorethamine

(also known as nitrogen mustard)

962 Chapter 22 The Chemistry of Life

FIGURE 22.34

Tetracycline is an antibiotic useful for

treating many human infections.

OH HOOO

N(CH

)

CONH

COOH

FIGURE 22.33

Penicillin was ﬁrst identiﬁed on

moldy slices of bread.

derived from the basic structure of tetracycline (Figure 22.34). They work by

binding to and inhibiting enzymes that catalyze protein synthesis in bacteria.

Anticancer Agents

One major strategy for treating cancer is to prevent the replication of DNA

within cancerous cells. If DNA replication is prevented, the cells cannot multiply

by cell division. Various drugs have been developed that achieve this effect by

forming crosslinks between the two strands of DNA or by adding bulky groups to

one strand, thus preventing the double helix from unwinding in the manner re-

quired for replication. One of the oldest anticancer drugs is mechlorethamine,

shown in Figure 22.35, which forms crosslinks between the DNA strands. A more

recent anticancer agent called m-amsacrine inserts into the DNA helix and causes

the cell’s natural maintenance enzymes to break the DNA strand into little pieces.

m-Amsacrine is very effective in treating some forms of childhood leukemia.

NHSO

m-Amsacrine

(m-AMSA)

FIGURE 22.35

Application

Hormones and Their Mimics

Insulin, injected under the skin, can be used to treat diabetic patients. Many other

nonprotein hormones are also used to treat disease. One major category of such

hormones consists of the steroid hormones, such as estrogen and testosterone.

Natural and synthetic steroids are used to treat

such conditions as cancer, rheumatoid arthritis,

allergies, and a wide range of hormone-deﬁciency

diseases. Synthetic steroids are also the active ingre-

dients in contraceptive pills and in the hormone re-

placement therapy sometimes used to combat the

effects of menopause in women.

Neurotransmitters

The nervous system is composed of billions of nerve cells that communicate with

one another via the release of small organic compounds known as neurotrans-

mitters. These chemicals bind to speciﬁc receptors on the surface of neighboring

nerve cells and either activate or inhibit the transmission of nerve impulses.

Many degenerative and psychiatric conditions are associated with abnormalities

in neurotransmitter function. The pronounced tremors of Parkinson’s disease,

for example, are due to the degeneration of nerve cells that use a molecule known

as dopamine as their neurotransmitter. The condition can be dramatically allevi-

ated by administering a precursor of dopamine called

L-Dopa, which is converted

to dopamine by enzymes in the body.

One of the most signiﬁcant neurotransmitters is serotonin (5-hydroxytrypta-

mine). A large new range of drugs that appeared in the 1990s are useful because

of their ability to modulate the effects of this neurotransmitter in various cells

and tissues.

Another set of signiﬁcant neurotransmitters are the endorphins, a class of

short polypeptides. Long-distance runners know the calming effects of endor-

phins. They give rise to the (nonaddictive) “runner’s high” that relieves stress for

hours after a long run. Many of the endorphins have also been implicated in

other signiﬁcant biological effects. For instance, substance P shows remarkable

activity in ocular wound repair.

22.10 A Look to the Future 963

Prednisone is a synthetic hormone simi-

lar to cortisone that is used to treat

Crohn’s disease and a wide variety of

other ailments. The basic structure of

this compound reveals that it is a

steroid.

L-Dopa

Serotonin

Application

Alpha-neo-endorphin

glu

gly

lys

tyr

ala

asn

lys

ile

ala

asn

lys

phe

leu

thr

val

leu

pro

thr

gln

ser

lys

glu

ser

thr

met

phe

gly

tyr

lys

pro

tyr

lys

arg

leu

phe

gly

tyr

pro

tyr

lys

arg

leu

phe

gly

tyr

Beta-neo-endorphin

Human-beta-endorphin

arg

pro

lys

pro

gln

phe

gly

leu

met

Substance P

Genetic Disease

Genetic diseases are those that are clearly associated with one or more abnormal

genes or larger abnormalities in genetic material. Genetic abnormalities give rise

to sickle-cell anemia, retinitis pigmentosa, obesity, and a host of other diseases.

How does damage in the gene cause disease? For each defective gene, there will be

a correspondingly defective protein where at least one amino acid has been re-

placed with an incorrect amino acid. Unfortunately, it is also possible to have ab-

normalities in the

chromosomes in which all of our DNA is packaged. Humans

contain 23 pairs of chromosomes, one copy of each pair inherited from each par-

ent. Having damaged, extra, or missing chromosomes can cause serious diseases.

One of the main driving forces behind the Human Genome Project that we

mentioned at the beginning of this chapter is the desire to identify all the genes

that are involved in genetic diseases. In doing so, scientists can learn exactly what

has gone wrong with them and, in many cases, discover how to compensate for

the defective proteins encoded by the genes. Eventually, we may even be able to

develop ways to repair the genes and restore their normal state. The idea of actu-

ally repairing genetic damage is known as

gene therapy. This advancement in sci-

ence is currently in the early stages of development and trials. Someday, in the not

too distant future, gene therapy may be performed on unborn babies to treat

their diseases before we welcome them into this oh, so interesting world.

964 Chapter 22 The Chemistry of Life

Application

The Bottom Line

■

DNA is a polymer of nucleotides made from two

complementary single strands wrapped around each

other to form a double helix. (Section 22.1)

■

Proteins are polymers of amino acids linked through

an amide bond (Section 22.2). They contain pri-

mary, secondary, tertiary, and sometimes quaternary

structure. (Sections 22.2, 22.3)

■

Proteins are made by translating the genetic code

from mRNA. tRNA supplies the speciﬁc amino acids

to the growing polypeptide chain. The construction

occurs at the ribosomes within the cytoplasm of a

cell. (Section 22.3)

■

Enzymes are proteins that contain an active site and

catalyze biochemical reactions. (Section 22.4)

■

Carbohydrates function as structural features such as

cell walls in plants and as energy storage molecules

in all living organisms. (Section 22.6)

■

Lipids are a diverse class of molecules with a variety

of functions. (Section 22.7)

■

Biological systems exploit the use of enantiomers.

Most amino acids and carbohydrates in living

organisms are only one of two possible enantiomers.

(Section 22.9)

■

The promising future activities in the chemistry of

medicines include development of new antibiotics,

new drugs to treat neurological disorders and cancer,

and gene therapy. (Section 22.10)

Endorphins include many

short-chain polypeptides.

active site The location on an enzyme where the re-

action of the substrate is catalyzed. (p. 948)

amide bond A bond constructed from the condensation

of an amine and a carboxylic acid. Represented by the

following general structure. (p. 940)

anabolism The metabolic process of constructing mole-

cules from smaller molecules using high-energy mol-

ecules that have been made by catabolism. (p. 958)

antibiotics Substances that kill, harm, or retard the

growth of microorganisms. (p. 961)

antibodies Large biological molecules that are produced

during an immune response, travel to the site of infec-

tion, bind to foreign material, and signal the destruc-

tion of the foreign material. (p. 954)

anticodon The three-nucleic-acid-sequence on a tRNA

polymer that recognizes and binds to the codon on

an mRNA polymer. (p. 943)

base pair A pair of nucleic acids that are intermolecu-

larly bound to each other through noncovalent forces

of attraction—for example, the combination of A

and T or of G and C in a DNA duplex. (p. 936)

biochemical pathway A sequence of biochemical reac-

tions that lead to the consumption or production of a

particular metabolite. (p. 958)

carbohydrates Compounds that have the general for-

mula C

. These compounds serve living or-

ganisms as structural molecules (cellulose), as cellular

recognition sites, and for energy storage (starch).

(p. 954)

catabolism The metabolic process of breaking down

molecules to form smaller molecules and produce

high-energy molecules. (p. 958)

chromosomes The packaged functional units of DNA.

(p. 964)

codon A three-nucleic-acid sequence on an mRNA that

is translated into a particular amino acid during pro-

tein synthesis. (p. 943)

collagen A structural protein that exhibits a linear

tertiary structure formed from intertwined alpha

helices. It is found in connective tissues in the body.

(p. 946)

denature To destroy the biochemical activity of a

protein. (p. 946)

deoxyribonucleic acid (DNA) A huge nucleotide polymer

that has a double-helical structure. Each strand of the

DNA polymer complements the other by forming

base pairs. DNA provides instructions for the synthe-

sis of proteins and enzymes that carry out the biolog-

ical activities of the cell. (p. 935)

deoxyribose A dehydrated carbohydrate used in the con-

struction of DNA. (p. 935)

disaccharide A carbohydrate made from the condensa-

tion of two simple sugars. (p. 956)

enantiomers A pair of molecules that are nonsuperim-

posable mirror images. (p. 960)

fat A triglyceride that is made from carboxylic acids

with long carbon chains and has a relatively high

melting point. Typcially derived from animal sources.

(p. 957)

fatty acids Carboxylic acids that contain long carbon

chains. Commonly serve as major building blocks for

the production of cell membranes. (p. 957)

gene A speciﬁc region of the DNA polymer that codes

(carries instructions) for a single protein. (p. 941)

gene therapy A relatively new area of biochemistry and

medicine wherein attempts are made to cure or treat

genetic diseases by modiﬁcation of a patient’s dam-

aged genes. (p. 964)

hormones Small molecules, such as steroids, used by

living organisms for intercellular communication.

(p. 953)

lipids Biological compounds characterized by their

ability to dissolve in nonpolar solvents. They include

fatty acids, some vitamins, and the steroid hormones.

(p. 957)

messenger RNA (mRNA) A short-lived single strand of

ribonucleic acid that carries the information from a

gene to the ribosomes where a protein is constructed.

(p. 942)

metabolism The biochemical reactions inside living

cells. (p. 958)

metabolite A product of each step in a biochemical

pathway. (p. 958)

monosaccharide A small carbohydrate monomer. Typi-

cally contains between three and nine carbon atoms.

(p. 956)

nitrogenous organic base The portion of a nucleotide

where hydrogen bonding holds the strands of DNA

together in a duplex. (p. 935)

nucleotides Monomers of the nucleic acids. A nu-

cleotide contains a ﬁve-carbon sugar, a phosphate,

and a nitrogenous organic base. (p. 935)

oil A triglyceride made from carboxylic acids with long

carbon chains and a relatively low melting point.

Typically derived from plant sources. (p. 957)

phospholipid A phosphate-modiﬁed lipid. (p. 957)

polypeptide A polymer of amino acids linked by amide

bonds. (p. 941)

Key Words 965

Key Words

polysaccharide A polymer of carbohydrate monomers.

(p. 956)

primary structure The sequence of amino acids within a

protein. (p. 941)

protein A large polymer of amino acids. May contain

one or more polypeptides and often involves complex

and intricate folds of the chain. (p. 939)

quaternary structure The way in which two or more

polypeptide chains have folded to make a protein.

(p. 946)

racemic mixture A 1:1 mixture of two enantiomers.

(p. 961)

racemization The reaction that describes the prepara-

tion of a racemic mixture from a single enantiomer.

(p. 961)

regulation The control of the function of a gene or

enzyme. (p. 948)

replication The process by which DNA is duplicated

prior to cell division. (p. 938)

residue The portion of an amino acid that differs from

other amino acids. (p. 940)

ribonucleic acid (RNA) A nucleotide polymer that con-

tains the information from a single gene and either

transfers that information to the ribosomes (mRNA)

or recognizes and constructs the protein product

(tRNA). (p. 941)

ribosomes Large molecular structures within the cyto-

plasm of a cell that aid the construction of a protein

from mRNA, tRNA, and the amino acid building

blocks. (p. 944)

secondary structure The speciﬁc folds within a polypep-

tide chain. Common secondary structures include the

alpha helix and the beta pleated sheet. (p. 945)

steroids Molecules composed of three 6-member

carbon rings and one 5-member carbon ring fused

together. These compounds are part of the lipid

fraction of a cell and function as structural materials

and intercellular communicators. (p. 957)

substrate A reactant molecule that binds to an enzyme.

(p. 948)

sugars The simplest carbohydrates. (p. 955)

tertiary structure The way in which secondary structures

fold together within a polypeptide chain. (p. 946)

transcription The process by which mRNA is synthe-

sized from a gene. (p. 941)

transfer RNA (tRNA) A nucleic acid polymer that recog-

nizes the codon on mRNA and adds the correspond-

ing amino acid to the growing protein. (p. 943)

translation The process by which a protein is synthe-

sized from mRNA. (p. 941)

triglyceride (triacylglycerol) A molecule made from three

fatty acids and a molecule of glycerol. Functions as

structural material in cell membranes and as an

energy storage molecule. (p. 957)

vitamins Small molecules that we need for proper

health. Normally, vitamins either are not synthesized

in our bodies or are made in insufﬁcient amounts.

(p. 950)

966 Chapter 22 The Chemistry of Life

Focus Your Learning

The answers to the odd-numbered problems and some selected

problems appear at the back of the book, as represented by the

blue numbering.

Section 22.1 DNA—The Basic Structure

Skill Review

1. Deﬁne the term DNA.

2. Deﬁne the term nucleic acid.

3. Indicate the complement for the following DNA sequence:

ATTAAAAAGGGACTA

4. Indicate the complement for the following DNA sequence:

GGCGAATTAGCCCA

Chemical Applications and Practices

5. A researcher has determined that a particular sequence in

double-stranded DNA can be cleaved by a laboratory

method. The method is speciﬁc for breaking DNA in the

middle of an ATTA sequence. How many breaks would occur

if the following single strand of DNA were paired with its

complement?

ATTAAAGCCTAATTACCATAAT

6. A short segment of DNA is prepared as a way to locate a

particular sequence in double-stranded DNA. To how many

locations would the following segment of DNA bind in the

double-stranded DNA shown?

Segment: ATGCA

DNA: TCGATTACGTATGCATTACGT

Section 22.2 Proteins

Skill Review

7. Cite two amino acids that differ by one carbon in their side

groups.

8. Cite two amino acids that have acidic side groups.

9. Show the two products that could result from the condensa-

tion of valine and phenylalanine. Identify the amide bonds in

each peptide.

10. Draw the three peptides that could be made from the con-

densation of two glycines and one proline. Identify the amide

bonds in each peptide.

Section 22.3 How Genes Code for Proteins

Skill Review

11. Deﬁne the term codon in your own words.

12. Describe the process of transforming the information in a

gene into a protein.

13. Explain how a mistake in the preparation of an mRNA could

result in a protein that contains the wrong amino acid.

14. Is it possible to have a mistake in a gene without a mistake in

the protein made by that gene? Explain.

Chemical Applications and Practices

15. A researcher isolates a fragment of a particular mRNA. Is this

fragment at the beginning, end, or somewhere in the middle

of the part that is translated into a protein?

UUUCGAAGUAUGGGUGGAGAUUCUCCCGCG

16. A particular genetic disorder causes an extra nucleotide to be

inserted into the mRNA of a gene. Assuming that the entire

mRNA is shown below and that the site of insertion is indi-

cated, what is the primary structure of a protein that would

result from the insertion of each of the four nucleotides?

AUG–AAU–UAU–CGG–AUU–UAA

17. The skeleton inside a cell is made up of microﬁlaments—

polymers of the protein known as actin. Judging on the basis

of the structure shown here, indicate whether actin is a glob-

ular or a ﬁbrous protein?

Focus Your Learning

967

Actin

ATP

An actin protein holds a molecule of ATP.

Keratin

CH C

Enzyme

CH C

Enzyme

18. Keratin is a protein used in deﬁning and holding the

structure of skin, hair, and claws. Judging on the basis of the

structure shown here, indicate whether keratin is a globular

or a ﬁbrous protein?

Section 22.4 Enzymes

Skill Review

19. Identify the class of enzyme based on the following reaction:

20. Identify the class of enzyme based on the following reaction:

21. In some enzymatic reactions, the product is able to bind to

the active enzyme and inhibit its activity. Why would this be

a useful feature for an enzyme? Explain.

22. In some metabolic pathways (biochemical reactions involv-

ing multiple reactions), large concentrations of the ﬁnal

product can turn off the activity of the ﬁrst enzyme in the

pathway, as shown below. What advantage would this type of

regulation have over that described in Problem 21? Explain.

Enzyme 4

Product C

Enzyme 3

Product B

Enzyme 1

End product

Enzyme 2

Feedback inhibition

Product A