Hatano Y., Katsumura Y., Mozumder A. (Eds.) Charged Particle and Photon Interactions with Matter - Recent Advances, Applications, and Interfaces

Подождите немного. Документ загружается.

950 Charged Particle and Photon Interactions with Matter

Recently, the chimerical structure in axillary buds of chrysanthemum has been investigated

(Yamaguchi et al., 2009b). Although no signicant difference has been found in mutation frequency

between gamma rays and ion beams, all the ower-color mutants induced by gamma rays were

periclinal chimeras, whereas solid mutants were frequently induced by ion beams. This result suggests

that not only mutation induction in a cell but also selection of mutation in a multicellular system

should be considered for mutation frequency and spectrum.

33.4.5 Molecular nature of Mutation induced by ion beaMS

For analyzing mutations at a molecular level, several techniques such as chromosomal mapping,

polymerase chain reaction (PCR), TAIL-PCR, cloning, and sequencing have been carried out

(Shikazono et al., 2001, 2003, 2005) (Table 33.5). In the case of C ions, 14 loci out of 29 possessed

intragenic point-like mutations, such as base substitutions, or deletions from several to hundreds of bases.

Fifteen out of 29 loci, however, possessed intergenic DNA rearrangement (“large mutations”) such as

chromosomal inversions, translocations, and deletions. In the case of electrons, nine alleles out of twelve

loci had point-like mutations and three out of twelve loci had DNA rearrangements. Sequence anal-

ysis revealed that C-ion-induced small mutations were mostly short deletions. Furthermore, analysis

of chromosome breakpoints in large mutations revealed that C ions frequently deleted small regions

around the breakpoints, whereas electron irradiation often duplicated these regions. Most of these

break-and-rejoin sites for rearrangements have microhomologies, suggesting that nonhomologous

end-joining (NHEJ) plays an important role for the rejoining of DSBs induced by these radiations.

Thus, rearrangements induced by carbon ions have a preferably different molecular nature than those

induced

by electrons at a low LET (Figure 33.5).

33.5 novel mutants induCed by ion beams

Ion beams induce novel and new phenotypes, and mutations have been induced in most of the plants

and

crops investigated (Figure 33.6). Here, we will introduce their characteristics.

33.5.1 Model plantS

In an attempt to isolate novel mutants induced by ion beams, Arabidopsis (Arabidopsis thaliana

(L.) Heynh.) was used as a model plant because thousands of Arabidopsis mutants were already

induced by chemical mutagens, x-rays, T-DNA, etc. As one of such mutant phenotypes, ultraviolet

table 33.5

Characteristics

of m

utation-induced

Carbon

onsand

electrons

tt,gl loci

Carbon ions electrons

point-

mutation

arge dna

arrangement

point-

mutation

arge dna

arrangement

Mutation 48% 52% 75% 25%

(as 100%) (as 100%)

Deletion 79% 44%

Base substitution 14% 44%

Insertion 7% 11%

Breakpoint (as 100%) (as 100%)

Deletion 65% 13%

Duplication 24% 75%

Applications to Biotechnology: Ion-Beam Breeding of Plants 951

TGATTACTAGGTTCAGTGATAA3

ACTAATGATCCAAGTCACTATT5

DSB

TGATTAC

ACTAATGATCCAA

TAGGTTCAGTGATAA3

GTCACTATT5

Annealing

TGATTAC

ACTAATGATCCAA

TAGGTTCAGTGATAA3

GTCACTATT5

Fill-in ligation

TGATTACTAGGTTAGGTTCAGTGATAA3

ACTAATGATCCAAACCAAGTCACTATT5

Duplication

High LET radiation

(carbon ions)

TGATTAC

ACTAATGATCCAA

TAGGTTCAGTGATAA3

GTCACTATT5

TGATTAC

ACTAAT

AGTGATAA3

GTCACTATT5

TGATTACAGTGATAA3

ACTAATGTCACTATT5

Excision, annealing,

ligation

Deletion

Damage

Low LET radiation

(electrons)

TAGGTTC

GATCCAA

Figure 33.5 A model of DNA DSB rejoining after irradiation by high LET radiation such as carbon ions, and

by irradiation of low LET radiation such as gamma rays, x-rays, and electrons. The ends of carbon-ion-induced

DSBs are excised, followed by annealing of the ends by ligation. By contrast, the ends of electron-induced DSBs

are annealed using complementary sequences and are subsequently duplicated by ll-in ligation.

Figure 33.6 Novel mutants and varieties induced by ion beams. From top left to right: 1 month old

Arabidopsis plants, wild type (upper rank) and UV-B resistant mutants (lower rank) under high UV-B

condition; avonoid accumulating seed of the Arabidopsis tt19 mutant; potato virus Y resistant tobacco;

new barley mutant resistant to barley yellow mosaic virus. From bottom left to right: new chrysanthemum

complex-color variety, “Ion-no-Seiko”; new rose-ower type carnation variety; new chrysanthemum variety

“Aladdin,” which has reduced axillary ower buds; new variety “KNOX” of Ficus pumila, which has a high

capability

for the uptake and assimilation of atmospheric nitrogen dioxide.

952 Charged Particle and Photon Interactions with Matter

light-B (UV-B) resistant or sensitive mutants were obtained by irradiation with 18.3MeV/u carbon

ions, and the genes responsible have been identied (Tanaka et al., 2002; Sakamoto et al., 2003;

Hase et al., 2006). New anthocyanin-accumulating or anthocyanin-defective mutants were also

obtained (Tanaka et al., 1997b; Shikazono et al., 2003; Kitamura et al., 2004). A novel ower

mutant, frill1, which has serrated petals and sepals, and the gene responsible for this phenotype

have been found (Hase et al., 2000, 2005). A novel auxin mutant, the aar1-1, was also obtained by

irradiation with carbon ions (Rahman et al., 2006). In Lotus japonicus, which is used as a model

leguminous plant, a novel hypernodulation mutant named klavier (klv) was isolated following

irradiation with helium ions (Oka-Kira et al., 2005). Thus, not only new mutants but also new

genes can be discovered using ion-beam-induced mutagenesis.

33.5.2 cropS

As the rst challenge for mutation induction by ion beams, mutants resistant to bacterial leaf blight

and blast disease were induced in rice. Higher mutation frequency was found in the ion-beam treat-

ment compared to gamma rays or thermal neutrons (Nakai et al., 1995). Two mutant lines of yellow

mosaic virus–resistant barley were found in a screen of ca. 50,000 M2 families (Kishinami et al., 1994).

Byexposure of tobacco anthers to ion beams, high frequency (2.9%–3.9%) of mutants resistant to potato

virus Y was obtained for carbon and helium ions irradiation (Hamada et al., 1999). Recently, banana

mutants tolerant to black Sigatoka in vitro were induced by carbon ions (Reyes-Borja et al., 2007).

In addition to disease resistance, chlorophyll mutant phenotypes were frequently observed in these

crops. About 2.1% of the M2 generation derived from barley seed exposed to carbon ions were chlorophyll

decient mutants (Kishinami et al., 1996). An albino mutant of tobacco was obtained by irradiation with

nitrogen ions at an early stage of embryonic development (Bae et al., 2001). A high frequency (11.6%) of

chlorophyll decient mutants, including an albino mutant, was obtained in rice by irradiation with neon

ions (Abe et al., 2002). A variegated yellow leaf mutant of rice, which can be induced by the activation of

endogenous transposable element, was also induced by carbon ions (Maekawa et al., 2003).

33.5.3 ornaMental flowerS

As described above, complex and stripe types of ower-color have been obtained in chrysanthemum

(Nagatomi et al., 1997). Morphological mutant phenotypes have also been observed in chrysan-

themum (Ikegami et al., 2005). One of these mutations, a reduced axillary ower bud mutant, was

induced by carbon ions for the rst time (Ueno et al., 2002). Recently, by means of re-irradiation

of this mutant with carbon ions, the ideal characters of not only a few axillary ower buds but also

low temperature owering were obtained (Ueno et al., 2004). In addition to the carnation varieties

described above (Okamura et al., 2003), mutants of petunia with altered ower color and form have

been induced by ion beams (Okamura et al., 2006). In rose, mutants with more intense ower colors

or mutants in the number of petals, ower size, and shape have been obtained (Yamaguchi etal.,

2003). Mutants induced by nitrogen or neon ions in Torenia include two groups of ower-color

mutants, one that lacks genes required for color or pigment production and another in which their

expression is altered (Miyazaki et al., 2006). In cyclamen, ion-beam irradiation of the tuber was

found to be more useful for changing ower characteristics than irradiation of other structures such

callus, somatic embryo, and so on (Sugiyama et al., 2008).

33.5.4 treeS

Ion beams have been used for generating mutants for tree breeding. Wax mutants and chlorophyll

mutants such as Xanta and Albino were obtained in the forest tree, Hinoki cypress (Ishii et al.,

2003). Shoot explants of Ficus pumila were irradiated with several kinds of ion beams to increase

the capability of plants to assimilate atmospheric nitrogen dioxide (Takahashi et al., 2005). A mutant

Applications to Biotechnology: Ion-Beam Breeding of Plants 953

variety with 40%–80% greater capability to assimilate atmospheric nitrogen dioxide has been

induced. Completely thornless Yuzu (Citrus junos) mutants together with several mutants with

weak thorns or lesser number of thorns have been obtained by the irradiation of 26.7MeV/u carbon

ions

(Matsuo et al., 2008).

33.6 other biologiCal eFFeCts oF ion beams

33.6.1 croSS incoMpatibility

In plant breeding, obtaining an interspecic hybrid is important for introducing desirable genes from

wild species to cultivated species. However, it is very difcult to obtain a viable hybrid plant between

widely related species. These problems would predominantly come from sexual reproduction such as

cross incompatibility, hybrid inviability, and so on.

The wild species of tobacco, Nicotiana gossei, has been reported to be resistant to more diseases

and insects than other Nicotiana species; several attempts to hybridize it with N. tabacum (cultivar)

have been made. In N. gossei crossed with N. tabacum, it was easy to get hybrid seeds with conven-

tional cross, but the hybrid plants did not survive. In order to overcome the cross incompatibility,

mature pollens from N. tabacum cv Bright Yellow 4 were irradiated with helium ions from tandem

accelerator (6MeV). Two viable hybrid plants were obtained at the rate of 1.1 × 10

−3

. Both the hybrids

were resistant to tobacco mosaic virus and aphid although the degree of resistance varied. With varying

energy and kind of ions, hybrid production rate ranged from 10

−3

to 10

−2

(Inoue et al., 1994; Yamashita

et al., 1995, 1997). The highest rate, 3.6 × 10

−2

, was obtained with 10Gy of 100MeV helium ion beams.

In the case of gamma irradiation, the rate of producing hybrids was 3.7 × 10

−5

. Thus, ion beams are

powerful tools to overcome hybrid incompatibility.

33.6.2 Sex Modification

Sex modication of a dioecious species, spinach, has been rst observed when exposed to ion beams

(Komai et al., 2003). Not only gynomonoecious but also andromonoecious plants have been induced

from female plant seeds irradiated with helium ions. As the frequencies of sex modication are very

high, it is plausible that ion irradiation induces some kind of stress, consistent with previous ndings

that photoperiod, temperature, and subirrigation conditions could affect sex expression. This is very

useful for spinach breeding to maintain homogeneous female plants.

33.6.3 activation of endogenouS tranSpoSable eleMent

The possibility of activation of endogenous transposable element by ion beams was rst suggested

in variegated yellow leaf mutant in rice (Maekawa et al., 2003). When a rice variety with recessive

stable yellow leaf (yl) was irradiated with carbon ions, variegated leaves were found in M2 with a

good t to 3:1. Albino plants were obtained in segregated M2 or M3 generations. From the genetic

analysis, the gene conversion of recessive to dominant at germ line as well as somatic line would be

induced by carbon ions, strongly suggesting the activation of an inactivated endogenous transposable

element

in rice.

33.7 ConClusion and perspeCtive

From a number of investigations discussed above, it is plausible that the characteristics required

of ion beams for mutation induction are to induce mutants with a high frequency, to show a broad

mutation spectrum, and, therefore, to produce novel mutants. We hypothesize that chemical muta-

gens, such as EMS, and low LET ionizing radiations, such as gamma rays and electrons will pre-

dominantly induce many minor modications or DNA damages on DNA strands, thus producing

954 Charged Particle and Photon Interactions with Matter

several point-like mutations on the genome. In contrast, ion beams as high LET ionizing radiations

will efciently cause fewer but larger, irreparable DNA damages locally, resulting in a limited num-

ber

of null mutations (Figure 33.7).

For

basic research, the usage of ion beams as a new mutagen casts new light on creating novel

mutants that are necessary to step up to the next level of plant molecular biology. One of the most

important objectives of the postgenome age is to elucidate the function of genes. Unfortunately, it is

very difcult to apply the gene-knockout system that was used in mammals or bacteria in the plant

kingdom. Therefore, ion beams can create thousands of novel mutants that provide information on

the

function of the mutated gene.

Another

important point of view is the application of these new mutants for plant breeding,

especially for practical use. Several ower varieties have already been commercially utilized. For

example, new varieties of carnation with new ower colors or new petal shapes have been produced

not only in Japan but also in Europe. A new chrysanthemum variety with a few axillary ower buds,

named Aladdin, is currently being produced by more than 40 companies and associations. Japanese

well as other Asian groups have started to use ion beams for breeding purposes.

Although

ion beams have become established as a new mutagen, the present characterization of

ion-beam-induced mutations have been acquired almost exclusively using carbon ions with LET

of ca. 100–200keV/μm. Some information was obtained with other ions or at other energies. It is

necessary to evaluate the effect of ion beams with different kinds of ions and at different energies.

Another question is whether mutagens such as radiation could induce directed or adaptive mutation

(Cairns et al., 1988). Nagatomi et al. showed that the mutation rates of the ower color of plants

regenerated from oral petal was higher than those from leaf when both ion beams and gamma rays

were used (Nagatomi et al., 1997). The reason for this is thought to be that the genes of ower color

in oral petal cells are more active than those in leaf cells, and this may lead to higher mutation

Energy deposition

gamma rays

Irradiation to cell Mutation

Large DNA alteration:

large deletion, translocation,

inversion

Point-like mutation:

base substitution,

deletion, insertion

Gene

Gamma rays: 2000 spurs/Gy

Carbon ions: 4 tracks/Gy

Nucleus

Ion beams

Spur (~3 nm)

Core

(~3 nm)

300 nm

Characteristic of energy transfer of ion beams for mutation induction

Repair

Characteristics of ion-beam induced mutation for plant breeding

1. High mutation rate :Small samples/spaces for mutation breeding

2. Broad mutation spectrum :Producing new varieties and mutants

3. Minimum no. of mutation :Pinpoint-breeding without bad characters

Nucleus

Figure 33.7 Characteristics of ion-beam-induced mutation and its application for plant breeding.

Applications to Biotechnology: Ion-Beam Breeding of Plants 955

rate of plants regenerated from oral petals. A similar phenomenon was also found in inducing a

few auxiliary ower bud mutants. If directed mutation exists in plants, a combination of the best

ion with appropriate energy and doses, and a choice of the best organ or tissues of plant will cause a

high

induction of mutants that would be sufcient for obtaining the desired mutations.

aCknowledgments

We would like to thank N. Shikazono for sharing his original model of ion-beam-induced

mutation mechanism, and M. Okamura for sharing his data of mutation spectrum of ower color

and shapes produced by ion beams. Ion beam breeding (IBB) described here could not have

been achieved without great support from Dr. H. Watanabe, S. Nagatomi, and Dr. M.Inoue.

We would like to dedicate this chapter to Dr. S. Tano, one of the founders of IBB, who passed

away in July 2006.

reFerenCes

Abe, T., Matsuyama, T., Sekido, S., Yamaguchi, I., Yoshida, S., and Kameya, T. 2002. Chlorophyll-decient

mutants of rice demonstrated the deletion of a DNA fragment by heavy-ion irradiation. J. Radiat. Res.

43:

157–161.

Bae,

C. H., Abe, T., Matsuyama, T., Fukunishi, N., Nagata, N., Nakano, T., Kaneko, Y., Miyoshi, K.,

Matsushima,H., and Yoshida, S. 2001. Regulation of chloroplast gene expression is affected in ali, a

novel tobacco albino mutant. Ann. Bot. 88: 545–553.

Blakely,

1992. Cell inactivation by heavy charged particles. Radiat. Environ. Biophys. 31: 181–196.

Cairns, J., Overbaugh, J., and Miller, S. 1988.

The

origin of mutants. Nature 335: 142–145.

Degi,

K., Morishita, T., Yamaguchi, H., Nagatomi, S., Miyagi, K., Tanaka, A., Shikazono, N., and Hase, Y.

2004. Development of the efcient mutation breeding method using ion bema irradiation. JAERI-Rev.

2004-025:

48–50.

FAO/IAEA.

2006. FAO/IAEA Mutant Varieties Database. Plant breeding and genetics section Vienna, Austria.

http://www-mvd.iaea.org/MVD/default.htm.

Fukuda, M., Itoh, H., Ohshima, T., Saidoh, M., and Tanaka, A. 2004. New applications of ion beams to material,

space, and biological science and engineering. In Charged Particle Interactions with Matter: Chemical,

Physicochemical, and Biological Consequences with Applications. A. Mozumder and Y. Hatano (eds.),

pp.

813–859. New

York:

Marcel Dekker.

Goodhead,

D. T. 1995. Molecular and cell models of biological effects of heavy ion radiation. Radiat. Environ.

Biophys.

34: 67–72.

Hamada,

K., Inoue, M., Tanaka, A., and Watanabe, H. 1999. Potato virus Y-resistant mutation induced by

the combination treatment of ion beam exposure and anther culture in Nicotiana tabacum L. Plant

Biotechnol.

16: 285–289.

Hase,

Y., Shimono, K., Inoue, M., Tanaka, A., and Watanabe, H. 1999. Biological effects of ion beams in

Nicotiana tabacum

L. Radiat. Environ. Biophys. 38: 111–115.

Hase,

Y., Tanaka, A., Baba, T., and Watanabe, H. 2000. FRL1 is required for petal and sepal development in

Arabidopsis. Plant J.

24: 21–32.

Hase,

Y., Yamaguchi, M., Inoue, M., and Tanaka, A. 2002. Reduction of survival and induction of chromosome

aberrations

in tobacco irradiated by carbon ions with different LETs. Int. J. Radiat. Biol. 78: 799–806.

Hase,

Y., Fujioka, S.,Yoshida, S., Sun, G., Umeda, M., and Tanaka, A. 2005. Ectopic endoreduplication caused

sterol alteration results in serrated petals in Arabidopsis. J. Exp. Bot. 56: 1263–1268.

Hase,

Y., Trung, K. H., Matsunaga, T., and Tanaka, A. 2006. A mutation in the uvi4 gene promotes progression

endo-reduplication and confers increased tolerance towards ultraviolet B light. Plant J. 46: 317–326.

Hirono,

Y., Smith, H. H., Lyman, J. T., Thompson, K. H., and Baum, J. W. 1970. Relative biological effectiveness

of heavy ions in producing mutations, tumors, and growth inhibition in the crucifer plant, Arabidopsis.

Radiat. Res. 44: 204–223.

Ikegami, H., Kunitake, T., Hirashima, K., Sakai,Y., Nakahara, T., Hase,Y., Shikazono, N., and Tanaka, A. 2005.

Mutation induction through ion beam irradiations in protoplasts of chrysanthemum. Bull. Fukuoka Agric.

Res. Cent.

24: 5–9 (in Japanese).

956 Charged Particle and Photon Interactions with Matter

Inoue, M., Watanabe, H., Tanaka, A., and Nakamura, A. 1994. Interspecic hybridization between Nicotiana

gossei Domin and N. tabacum L., using 4He2+ irradiated pollen. JAERI TIARA Annu. Rep. 1993: 44–45.

Ishii, K.,Yamada,Y., Hase,Y., Shikazono, N., and Tanaka, A. 2003. RAPD analysis of mutants obtained by ion

beam irradiation to Hinoki cypress shoot primordial. Nucl. Instrum. Methods Phys. Res. B 206: 570–573.

Kazama,Y., Saito, H.,Yoshiharu,Y., Yamamoto,Y., Hayashi,Y., Ichida, H., Ryuto, H., Fukunishi, N., and Abe, T.

2008. LET-dependent effects of heavy-ion beam irradiation in Arabidopsis thaliana. Plant Biotechnol.

25:

113–117.

Kishinami,

I.,

Tanaka, A.,

and

Watanabe,

H. 1994. Mutations induced by ion beam (C5+) irradiation in barley.

JAERI TIARA Annu. Rep.

3: 30–31.

Kishinami,

I., Tanaka, A., and Watanabe, H. 1996. Studies on mutation induction of barley by ion beams.

Abstracts of the 5th TIARA Research Review Meeting

165: 6 (in Japanese).

Kitamura,

S., Shikazono, N., and Tanaka, A. 2004. TRANSPARENT TESTA 19 is involved in the accumulation

of both anthocyanins and proanthocyanidins in Arabidopsis. Plant J. 37: 104–114.

Komai, F., Shikazono, N., and Tanaka, A. 2003. Sexual modication of female spinach seeds (Spinacia

oleracea L.) by irradiation with ion particles. Plant Cell Rep. 21: 713–717.

Maekawa, M., Hase, Y., Shikazono, N., and Tanaka, A. 2003. Induction of somatic instability in stable yellow

leaf

mutant of rice by ion beam irradiation. Nucl. Instrum. Methods Phys. Res. B 206: 579–585.

Matsuo,

Y., Hase,Y.,Yokota, Y., Narumi, I., and Ohyabu, E. 2008. Induction of thornlessYuzu mutant by heavy

ion

beam irradiation. JAERI-Rev. 2007-060: 79.

Mei,

M., Deng, H., Lu, Y., Zhuang, C., Liu, Z., Qiu, Q., Qiu, Y., and Yang, T. C. 1994. Mutagenic effects of

heavy

ion radiation in plants. Adv. Space Res. 14: 363–372.

Miyazaki,

K., Suzuki, K., Iwaki, K., Kusumi, T., Abe, T., Yoshida, S., and Fukui, H. 2006. Flower pigment

mutations induced by heavy ion beam irradiation in an interspecic hybrid of Torenia. Plant Biotechnol.

23:

163–167.

Muller,

H. J. 1927.

Articial

transmutation of the gene. Science 66: 84–87.

Nagatomi,

S., Tanaka, A., Kato, A., Watanabe, H., and Tano, S. 1997. Mutation induction on chrysanthemum

plants regenerated from in vitro cultured explants irradiated with C ion beam. JAERI-Rev. 96-017: 50–52.

Nakai, H., Watanabe, H., Kitayama, A., Tanaka, A., Kobayashi, Y., Takahashi, T., Asai, T., and Imada, T. 1995.

Studies

on induced mutations by ion beam in plants. JAERI-Rev. 19: 34–36.

Oka-Kira,

E., Tateno, K., Miura, K., Haga, T., Hayashi, M., Harada, K., Sato, S., Tabata, S., Shikazono, N.,

Tanaka, A., Watanabe,Y., Fukuhara, I., Nagata, T., and Kawaguchi, M. 2005. klavier (klv), a novel hyper-

nodulation mutant of Lotus japonicus affected in vascular tissue organization and oral induction. Plant

44: 505–515.

Okamura,

M.,Yasuno, N., Ohtsuka, M., Tanaka,A., Shikazono, N., and Hase,Y. 2003. Wide variety of ower-color

and -shape mutants regenerated from leaf cultures irradiated with ion beams. Nucl. Instrum. Methods Phys.

Res. B 206: 574–578.

Okamura, M., Tanaka, A., Momose, M., Umemoto, N., da Silva, J. T., and Toguri, T. 2006. Advances of

mutagenesis in owers and their industrialization. In Floriculture, Ornamental and Plant Biotechnology,

Vol. I, pp. 619–628. London, U.K.: Global Science Books.

Rahman, A., Nakasone, A., Chhun, T., Ooura, C., Biswas, K. K., Uchimiya, H., Tsurumi, S., Baskin, T. I.,

Tanaka, A., and Oono,Y. 2006. A small acidic protein 1 (SMAP1) mediates responses of the Arabidopsis

root

to the synthetic auxin 2,4-dichlorophenoxyacetic acid. Plant J. 47: 788–801.

Redei,

G. P. and Koncz, C. 1992. Classical mutagenesis. In Methods in Arabidopsis Research, C. Koncz, N. H.

Chua

and J. Schell (eds.). Singapore:

World

Scientic Publishing Co. Pte. Ltd.

Reyes-Borja,

W. O., Sotomayor, I., Garzon, I.,Vera, D., Cedeno, M., Castillo, B., Tanaka,A., Hase,Y., Sekozawa,

Y., Sugaya, S., and Gemma, H. 2007. Alteration of resistance to black Sigatoka (Mycosphaerella jiensis

Morelet)

in banana by in vitro irradiation using carbon ion-beam. Plant Biotechnol. 24: 349–363.

Sakamoto,

A., Lan, V. T. T., Hase, Y., Shikazono, N., Matsunaga, T., and Tanaka, A. 2003. Disruption of the

AtREV3

gene causes hypersensitivity to ultraviolet B light and gamma-rays in

Arabidopsis:

Implication

the presence of a translation synthesis mechanism in plants. Plant Cell 15: 2042–2057.

Shikazono,

N., Tanaka, A., Watanabe, H., and Tano, S. 2001. Rearrangements of the DNA in carbon ion-induced

mutants of Arabidopsis thaliana. Genetics 157: 379–387.

Shikazono, N., Tanaka, A., Kitayama, S., Watanabe, H., and Tano, S. 2002. LET dependence of lethality in

Arabidopsis thaliana

irradiated by heavy ions. Radiat. Environ. Biophys. 41: 159–162.

Shikazono,

N.,Yokota,Y., Kitamura, S., Suzuki, C., Watanabe, H., Tano, S., and Tanaka, A. 2003. Mutation rate

and

novel tt mutants of Arabidopsis thaliana induced by carbon ions. Genetics 163: 1449–1455.

Shikazono,

N., Suzuki, C., Kitamura, S.,

Watanabe,

H., Tano, S., and Tanaka, A. 2005. Analysis of mutations

induced

by carbon ions in Arabidopsis thaliana. J. Exp. Bot. 56: 587–596.

Applications to Biotechnology: Ion-Beam Breeding of Plants 957

Shimono, K., Shikazono, N., Inoue, M., Tanaka, A., and Watanabe, H. 2001. Effect of fractionated exposure to

carbon ions on the frequency of chromosome aberrations in tobacco root cells. Radiat. Environ. Biophys.

40:

221–225.

Stadler,

L. J. 1928. Mutations in barley induced by x-rays and radium. Science 68: 186–187.

Sugiyama,

M., Saito, H., Ichida, H., Hayashi, Y., Ryuto, H., Fukunishi, N., Terakawa, T., and Abe, T. 2008.

Biological

effects of heavy-ion beam irradiation on cyclamen. Plant Biotechnol. 25: 101–104.

Takahashi,

M., Kohama, S., Kondo, K., Hakata, M., Hase, Y., Shikazono, N., Tanaka, A., and Morikawa, H.

2005. Effects of ion beam irradiation on the regeneration and morphology of Ficus thunbergii Maxim.

Plant Biotechnol.

22: 63–67.

Tanaka,

A., Shikazono, N.,Yokota,Y., Watanabe, H., and Tano, S. 1997a. Effects of heavy ions on the germination

and survival of Arabidopsis thaliana. Int. J. Radiat. Biol. 72: 121–127.

Tanaka, A., Tano, S., Chantes, T., Yokota, Y., Shikazono, N., and Watanabe, H. 1997b. A new Arabidopsis

mutant induced by ion beams affects avonoid synthesis with spotted pigmentation in testa. Genes Genet.

Syst.

72: 141–148.

Tanaka,

S., Fukuda, M., Nishimura, K., Watanabe, H., andYamano, N. 1997c. IRACM:A code system to calculated

induced radioactivity produced by ions and neutrons. JAERI-Data/Code 97-019.

Tanaka, A., Sakamoto, A., Ishigaki,Y., Nikaido, O., Sung, G., Hase,Y., Shikazono, N., Tano, S., and Watanabe,

H. 2002. An ultraviolet-B-resistant mutant with enhanced DNA repair in Arabidopsis. Plant Physiol.

129:

64–71.

Ueno,

K., Nagayoshi, S., Shimonishi, K., Hase, Y., Shikazono, N., and Tanaka, A. 2002. Effects of ion beam

irradiation

on chrysanthemum leaf discs and sweet potato callus. JAERI-Rev. 2002-035: 44–46.

Ueno,

K., Nagayoshi, S., Hase, Y., Shikazono, N., and Tanaka, A. 2004. Additional improvement of chrysan-

themum

using ion beam re-irradiation. JAERI-Rev. 25: 53–55.

Yamaguchi,

H., Nagatomi, S., Mrishita, T., Degi, K., Tanaka, A., Shikazono, N., and Hase, Y. 2003. Mutation

induced

with ion beam irradiation in rose. Nucl. Instrum. Methods Phys. Res. B 206: 561–564.

Yamaguchi,

H., Hase,Y., Tanaka, A., Shikazono, N., Degi, K., Shimizu,A., and Morishita, T. 2009a. Mutagenic

effects

of ion beam irradiation on rice. Breed. Sci. 59: 169–177.

Yamaguchi,

H., Shimizu, A., Hase, Y., Degi, K., Tanaka, A., and Morishita, T. 2009b. Mutation induction with

ion beam irradiation of lateral buds of chrysanthemum and analysis of chimeric structure of induced

mutants.

Euphytica 165: 97–103.

Yamashita,

T., Inoue, M., Watanabe, H., Tanaka, A., and Tano, S. 1995. Comparative analysis of interspecic

hybrids between Nicotiana gossei Domin and N. tabacum L., obtained by the cross with

-irradiated

pollen.

JAERI-Rev. 95-019: 37–39.

Yamashita,

T., Inoue, M., Watanabe, H., Tanaka, A., and Tano, S. 1997. Effective production of interspecic

hybrids between Nicotiana gossei Domin and N. tabacum L., by the cross with ion beam-irradiated

pollen.

JAERI-Rev. 96-017: 44–46.

Yokota,

Y., Yamada, S., Hase, Y., Shikazono, N., Narumi, I., Tanaka, A., and Inoue, M. 2007. Initial yields of

DNA double-strand breaks and DNA fragmentation patterns depend on linear energy transfer in tobacco

BY-2

protoplasts irradiated with helium, carbon and neon ions. Radiat. Res. 167: 94–101.

Yokota,

Y., Wada, S., Hase, Y., Funayama, T., Kobayashi, Y., Narumi, I., and Tanaka, A. 2009. Kinetic

analysis of double-strand break rejoining reveals the DNA reparability of γ-irradiated tobacco cultured

cells. J. Radiat. Res. 50: 171–175.

959

Radiation Chemistry

inNuclear

Engineering

Junichi Takagi

Toshiba Corporation

Yokohama,

Japan

Bruce J. Mincher

Idaho National Laboratory

Idaho

Falls, Idaho

Makoto Yamaguchi

Japan Atomic Energy Agency

Tokai,

Japan

Yosuke Katsumura

The University of Tokyo

Tokyo,

Japan

and

Japan

Atomic Energy Agency

Tokai, Japan

Contents

34.1 Introduction ..........................................................................................................................960

34.2 Application

of Radiation Chemistry to Power Plants........................................................... 961

34.2.1

Introduction .............................................................................................................. 961

34.2.2 Water

Chemistry Control in Light Water Reactors .................................................. 961

34.2.2.1

BWR

Water Chemistry.............................................................................. 961

34.2.2.2

PWR Water Chemistry ..............................................................................963

34.2.3 Evaluation

of Corrosion Environment in BWRs ......................................................964

34.2.3.1

Preventive

Water Chemistry ......................................................................966

34.2.3.2

Basic

Approaches to Control IGSCC.........................................................966

34.2.4

Modeling

Approach to BWR Corrosion Environment Evaluation...........................967

34.2.4.1

General Modeling Method......................................................................... 967

34.2.4.2 Radiolysis

Modeling ..................................................................................968

34.2.4.3

ECP

Modeling.............................................................................................973

34.2.4.4

ECP

Evaluation for BWR Primary Circuit................................................ 974

34.2.4.5

Advanced

ECP Evaluation Using 3-D Flow Distribution.......................... 974

34.2.5

Hydrogen Water Chemistry Application to Actual BWRs....................................... 976

34.2.5.1 Introduction................................................................................................976

34.2.5.2 Environmental

Mitigation of IGSCC by Hydrogen Water Chemistry.......976

34.2.5.3

Program

Description..................................................................................977

34.2.5.4

Experimental..............................................................................................978

34.2.5.5 Results and Discussion...............................................................................979

34.2.5.6 Hydrogen

Water Chemistry Summary ...................................................... 981