Voet D., Voet Ju.G. Biochemistry

Подождите немного. Документ загружается.

important immune system activator). We shall see in Sec-

tion 34-3Bff that the monoubiquitination of certain his-

tones functions to regulate transcription.

m. Ubiquitinlike Modifiers Participate in a Variety of

Regulatory Processes

Eukaryotic cells express several proteins that have the

same -Grasp fold as ubiquitin and are similarly conju-

gated to other proteins, although their surface residues and

charge distributions differ significantly.These ubiquitinlike

modifiers (Ubls), which participate in a variety of funda-

mental cellular processes, each have a corresponding acti-

vating enzyme (E1), at least one conjugating enzyme (E2),

and one or more ligases (E3s), that function to link the Ubl

to its target protein(s) in a manner closely resembling that

of ubiquitin.

Two of the most extensively studied Ubls are SUMO

(small ubiquitin-related modifier; 18% identical to ubiqui-

tin) and RUB1 (related-to-ubiquitin 1; called NEDD8 in

vertebrates; 50% identical to ubiquitin), proteins that are

highly conserved from yeast to humans.The sumoylation of

PCNA at the same Lys residue at which it is ubiquitinated

promotes normal DNA replication during S phase. The

sumoylation of IB at the same residue (Lys 21) at which

it is ubiquitinated blocks its ubiquitination and subsequent

degradation and thereby prevents the translocation of NF-

B to the nucleus. Evidently, there is a complex regulatory

interplay between the ubiquitination and sumoylation of

both PCNA and IB. SUMO also modifies two mam-

malian glucose transporters, GLUT1 and GLUT4 (Section

20-2Eb), and in doing so, increases the availability of

GLUT4 but decreases that of GLUT1.

All known RUB1 targets are cullins, all of which are

subunits of SCF complexes, the multisubunit RING E3s

(Section 32-6Bd). In fact, -TrCP, the E3 that directs the

ubiquitination of IB, must be conjugated to RUB1 be-

fore it can do so, thereby adding further complexity to the

control of NF-B.

Section 32-6. Protein Degradation 1421

Figure 32-89 Structure of the tricorn protease. (a) The X-ray

structure of its D

symmetric hexamer drawn in ribbon form and

viewed along its 3-fold axis. Its subunits are differently colored

with that on the lower right colored in rainbow order from its

N-terminus (blue) to its C-terminus (red). (b) View along the

hexameric complex’s 2-fold axis (rotated 90° about a horizontal

axis with respect to Part a). (c) A cryo-EM–based image of the

icosahedral complex. Each of its component “plates” represents

a hexameric complex such as those drawn in Parts a and b. Note

how neighboring plates are related by both 3-fold axes (which

are coincident with those of the hexameric complexes) and

5-fold axes.The white scale bar is 50 nm long. [Parts a and b are

based on an X-ray structure by Robert Huber, Max-Planck-

Institut für Biochemie, Martinsried, Germany. PDBid 1K32. Part

c is courtesy of Wolfgang Baumeister, Max-Planck-Institut für

Biochemie, Martinsried, Germany.]

(a)

(b)

(c)

JWCL281_c32_1338-1428.qxd 9/7/10 2:24 PM Page 1421

1422 Chapter 32. Translation

1 The Genetic Code Point mutations are caused by either

base analogs that mispair during DNA replication or by sub-

stances that react with bases to form products that mispair. In-

sertion/deletion (frameshift) mutations arise from the associa-

tion of DNA with intercalating agents that distort the DNA

structure. The analysis of a series of frameshift mutations that

suppress one another established that the genetic code is an

unpunctuated triplet code. In a cell-free protein synthesizing sys-

tem, poly(U) directs the synthesis of poly(Phe), thereby demon-

strating that UUU is the codon specifying Phe.The genetic code

was elucidated through the use of polynucleotides of known

composition but random sequence, by the ability of defined

triplets to promote the ribosomal binding of tRNAs bearing spe-

cific amino acids, and through the use of synthetic mRNAs of

known alternating sequences.The latter investigations have also

demonstrated that the 5¿ end of mRNA corresponds to the N-

terminus of the polypeptide it specifies and have established the

sequences of the Stop codons. Degenerate codons differ mostly

in the identities of their third base. Small single-stranded DNA

phages such as X174 contain overlapping genes in different

reading frames.The genetic code used by mitochondria differs in

several codons from the “standard” genetic code.

2 Transfer RNA and Its Aminoacylation Transfer RNAs

consist of 54 to 100 nucleotides that can be arranged in the

cloverleaf secondary structure. As many as 10% of a tRNA’s

bases may be modified. Yeast tRNA

Phe

forms a narrow,

L-shaped, three-dimensional structure that resembles that of

other tRNAs. Most of the bases are involved in stacking and

base pairing associations including nine tertiary interactions

that appear to be essential for maintaining the molecule’s na-

tive conformation. Amino acids are appended to their cognate

tRNAs in a two-stage reaction catalyzed by the corresponding

aminoacyl–tRNA synthetase (aaRS). There are two classes of

aaRSs, each containing 10 members. Class I aaRSs have two

conserved sequence motifs that occur in the Rossmann fold

common to the catalytic domain of these enzymes. Class II

aaRSs have three conserved sequence motifs that occur in the

7-stranded antiparallel  sheet–containing fold that forms the

core of their catalytic domains. In binding only their cognate

tRNAs, aaRSs recognize only an idiosyncratic but limited num-

ber of bases (identity elements) that are, most often, located at

the anticodon and in the acceptor stem. The great accuracy of

tRNA charging arises from the proofreading of the bound

amino acid by certain aminoacyl–tRNA synthetases via a dou-

ble-sieve mechanism and at the expense of ATP hydrolysis.

Many organisms and organelles lack a GlnRS and instead

synthesize Gln–tRNA

Gln

by the GluRS-catalyzed charging of

tRNA

Gln

with glutamate followed by its transamidation using

glutamine as the amido group source in a reaction mediated

by Glu–tRNA

Gln

amidotransferase (Glu-AdT). Ribosomes se-

lect tRNAs solely on the basis of their anticodons. Sets of de-

generate codons are read by a single tRNA through wobble

pairing. The UGA codon, which is normally the opal Stop

codon may, depending on its context in mRNA, specify a se-

lenoCys (Sec) residue, which is carried by a specific tRNA

(tRNA

Sec

), thereby forming a selenoprotein. Nonsense muta-

tions may be suppressed by tRNAs whose anticodons have

mutated to recognize a Stop codon.

3 Ribosomes and Polypeptide Synthesis The ribosome

consists of a small and a large subunit whose complex shapes

have been revealed by cryoelectron microscopy and X-ray

crystallography. The three RNAs and 52 proteins comprising

the E. coli ribosome self-assemble under proper conditions.

Both ribosomal subunits consist of an RNA core in which the

proteins are embedded, mainly as globular domains on the

back and sides of the particle, with long basic polypeptide seg-

ments that infiltrate between the RNA helices so as to neutral-

ize their anionic charges. Eukaryotic ribosomes are larger and

more complex than those of prokaryotes.

Ribosomal polypeptide synthesis proceeds by the addition

of amino acid residues to the C-terminal end of the nascent

polypeptide. The mRNAs are read in the 5¿S3¿ direction.

mRNAs are usually simultaneously translated by several ribo-

somes in the form of polysomes.The ribosome has three tRNA-

binding sites: the A site, which binds the incoming aminoacyl–

tRNA; the P site, which binds the peptidyl–tRNA;and the E site,

which transiently binds the outgoing deacylated tRNA. During

polypeptide synthesis, the nascent polypeptide is transferred to

the aminoacyl–tRNA, thereby lengthening the nascent

polypeptide by one residue. The newly deacylated tRNA is

translocated to the E site and the new peptidyl–tRNA, with its

associated codon, is translocated to the P site. In prokaryotes,

the initiation sites on mRNA are recognized through their

Shine–Dalgarno sequences and by their initiating codon.

Prokaryotic initiating codons specify . Initiation

involves the participation of three initiation factors that induce

the assembly of the ribosomal subunits with in

the P site and mRNA. Eukaryotic initiation is a far more com-

plicated process that requires the participation of at least 11 ini-

tiation factors. The system binds the mRNA’s 5¿ cap and scans

along the mRNA until it finds its AUG initiation codon, usually

the mRNA’s first AUG, through codon–anticodon interactions

with the initiating tRNA, .

Polypeptides are elongated in a three-part cycle, consisting

of aminoacyl–tRNA decoding, transpeptidation, and translo-

cation, that requires the participation of elongation factors

and is vectorially driven by GTP hydrolysis. EF-Tu, which

functions to escort aminoacyl–tRNAs into the ribosomal A

site, undergoes a major conformational change on hydrolyzing

its bound GTP. The X-ray structure of the 50S subunit clearly

shows that the ribosomal peptidyl transferase center is distant

from any protein and hence that the ribosome is a ribozyme.

Peptide bond formation is catalyzed by a substrate-assisted

mechanism in which the ribosome functions as an entropy

trap. Translocation is motivated through the EF-G–catalyzed

hydrolysis of GTP. EF-G  GDP, which binds to the same ribo-

somal site as aminoacyl–tRNA  EF-Tu  GTP, is a macromol-

ecular mimic of this complex. Translocation occurs via inter-

mediate states, the A/P and P/E states, in which the newly

formed peptidyl–tRNA and the newly deacylated tRNA are

respectively bound to the A and P subsites of the 30S subunit

and to the P and E subsites of the 50S subunit, following which

EF-G hydrolyzes its bound GTP and shifts these tRNAs to the

P/P and E/E states. The ribosome initially selects an aminoa-

cyl–tRNA whose anticodon is cognate to its A-site–bound

codon through interactions involving three universally con-

Met–tRNA

Met

fMet–tRNA

Met

fMet–tRNA

Met

CHAPTER SUMMARY

JWCL281_c32_1338-1428.qxd 8/19/10 10:06 PM Page 1422

served 30S subunit bases while the tRNA is in the A/T binding

state.The codon–anticodon interaction is then proofread in an

independent process that follows the hydrolysis of the EF-

Tu–bound GTP and which occurs when the tRNA has shifted

to the A/A binding state, a process called accommodation.

Termination codons bind release factors that induce the hy-

drolysis of the peptidyl–tRNA bond. Eukaryotic elongation

and termination resemble those of prokaryotes. Ribosomal in-

hibitors, many of which are antibiotics, are medically important

and biochemically useful in elucidating ribosomal function.

Streptomycin causes mRNA misreading and inhibits prokary-

otic chain initiation, chloramphenicol inhibits prokaryotic pep-

tidyl transferase, paromomycin causes codon misreading,tetra-

cycline inhibits aminoacyl–tRNA binding to the prokaryotic

30S subunit, and diphtheria toxin ADP-ribosylates eEF2.

4 Control of Eukaryotic Translation Several mechanisms

of translational control have been elucidated in eukaryotes.

eIF2 kinases catalyze the phosphorylation of eIF2,which then

tightly binds eIF2B so as to prevent it from exchanging eIF2-

bound GDP for GTP and hence inhibits translational initiation.

These eIF2 kinases include heme-regulated inhibitor (HRI),

which functions to coordinate globin synthesis with heme avail-

ability; double-stranded RNA-activated protein kinase (PKR),

an interferon-induced protein that functions to inhibit viral pro-

liferation; and PKR-like endoplasmic reticulum kinase (PERK),

which functions to protect the cell from the irreversible damage

caused by the accumulation of unfolded proteins in the ER.

GCN2, in contrast, is an eIF2 kinase that, when amino acids are

scarce, stimulates the translation of the transcriptional activator

GCN4 by causing the 40S ribosomal subunit to scan across four

upstream open reading frames (uORFs) in the GCN4 mRNA,

thereby permitting the ribosome to initiate translation at the

GCN4 coding sequence. The phosphorylation of eIF4E (cap-

binding protein) by a MAP kinase cascade increases eIF4E’s

affinity for capped mRNA and thereby stimulates translational

initiation. The binding of 4E-BPs to eIF4E blocks its binding of

eIF4G and hence prevents initiation. However, the insulin-in-

duced phosphorylation of the 4E-BPs causes them to dissociate

from eIF4E. The mRNAs in certain animal oocytes are masked

by the binding of proteins, which prevents their translation.

Many oocyte mRNAs have short poly(A) tails that are pre-

ceded by a cytoplasmic polyadenylation element (CPE) that is

bound by CPE-binding protein (CPEB). CPEB binds maskin

which binds eIF4E, thereby inhibiting translational initiation.

However, when CPEB is phosphorylated, it recruits poly(A)

polymerase (PAP), which extends the mRNA’s poly(A) tail

such that it is bound by poly(A)-binding protein (PABP).

PABP then binds to eIF4G, which in turn displaces maskin

from eIF4E, thereby permitting the translation of the mRNA.

Antisense oligonucleotides can be used to inhibit the transla-

tion of their complementary mRNAs.Although the delivery of

antisense oligonucleotides to their sites of action has proved

to be a difficult problem, their use is starting to show some

medical and biotechnological successes.

5 Post-Translational Modification Proteins may be post-

translationally modified in a variety of ways. Proteolytic cleav-

ages, usually by specific peptidases, activate proproteins. The

signal peptides of preproteins are removed by signal peptidases.

Covalent modifications alter many types of side chains in a va-

riety of ways that modulate the catalytic activities of enzymes,

provide recognition markers, and stabilize protein structures.

Protein splicing occurs via the intein-catalyzed self-excision

between an N-extein and a C-extein accompanied by the liga-

tion of the N- and C-exteins via a peptide bond. Most inteins

contain a homing endonuclease that makes a double-strand

nick in a gene similar to that encoding the corresponding extein,

thereby triggering a recombinational double-strand DNA re-

pair process that copies the gene encoding the intein into the

break. Inteins therefore appear to be molecular parasites.

6 Protein Degradation Proteins in living cells are contin-

ually turning over. This controls the level of regulatory en-

zymes and disposes of abnormal proteins that would other-

wise interfere with cellular processes. Proteins are degraded

by lysosomes via a nonspecific process as well via a process

specific for KFERQ proteins that is stimulated during starva-

tion. A cytosolically based ATP-dependent system degrades

normal as well as abnormal proteins in a process that flags

these proteins by the covalent attachment of Lys 48–linked

polyubiquitin chains to their Lys residues. This process is me-

diated by three consecutively acting enzymes: ubiquitin-acti-

vating enzyme (E1), ubiquitin-conjugating enzyme (E2), and

ubiquitin–protein ligase (E3). Most cells have one species of

E1, several species of E2, and numerous species of E3, each of

which is served by one or a few E2s. The polyubiquitinated

protein is proteolytically degraded in the 26S proteasome.

E3s can have complicated modular structures, each having

different specificities for target proteins. SCF complexes, one

of whose several subunits contains a RING domain,are partic-

ularly elaborate. The RING E3 known as E3 functions to

ubiquitinate proteins that satisfy the N-end rule.The transcrip-

tion factor NF-B is activated through the ubiquitination and

subsequent destruction of its otherwise bound inhibitor IB

by the SCF -TrCP, which is activated through phosphoryla-

tion via a signal transduction cascade. Cyclins, which mediate

the cell cycle, are destroyed in a programmed manner through

ubiquitination by their cognate E3s, one of which is anaphase-

promoting complex (APC).

The 26S proteasome consists of a hollow protein barrel

formed by two rings of seven  subunits flanking two rings of

seven  subunits known as the 20S proteasome, which is

bound at each end by 19S caps that each consist of ⬃18 sub-

units. The active sites of the  subunits, which are members of

the N-terminal nucleophile (Ntn) family of hydrolases, are in-

side the barrel. Ubiquitinated proteins are selected by the 19S

caps, which unfold them in an ATP-dependent matter and

then feed them into the 20S proteasome via its axial channel.

The polyubiquitin (polyUb) chains are excised from the con-

demned protein by proteasome-associated deubiquitinating en-

zymes (DUBs), while other DUBs dismember the polyUb

chains to their component ubiquitin units, thereby recycling

them. The 11S activator is a heptameric complex that, on bind-

ing to one end of a 20S proteasome, opens its axial channel in an

ATP-independent manner, thereby permitting polypeptides, but

not folded proteins, to enter the 20S proteasome. Eubacteria,

nearly all of which lack proteasomes, nevertheless express a va-

riety of self-compartmentalized proteases, including ClpP, heat

shock locus UV (HslUV), and tricorn protease, that function to

proteolytically dispose of their cellular proteins. Monoubiquiti-

nation and polyubiquitination with chains linked through ubiq-

uitin residues other than Lys 48 regulate a variety of cellular

processes. Ubiquitinlike modifiers (Ubls), such as SUMO and

RUB1, also participate in numerous regulatory processes.

Chapter Summary 1423

JWCL281_c32_1338-1428.qxd 9/7/10 2:24 PM Page 1423

1424 Chapter 32. Translation

General

Watson, J.D., Baker, T.A., Bell, S.P., Gann, A., Levine, M., and

Losick, R., Molecular Biology of the Gene (6th ed.), Chap. 14

and 15, Cold Spring Harbor Laboratory Press (2008).

The Genetic Code

Attardi, G., Animal mitochondrial DNA: an extreme example of

genetic economy, Int. Rev. Cytol. 93, 93–145 (1985).

Benzer, S., The fine structure of the gene, Sci. Am. 206(1), 70–84

(1962).

Crick, F.H.C.,The genetic code, Sci.Am. 207(4), 66–74 (1962) [The

structure of the code as determined by phage genetics]; and

The genetic code: III, Sci.Am. 215(4),55–62 (1966).[A descrip-

tion of the nature of the code after its elucidation was almost

complete.]

Crick, F.H.C., Burnett, L., Brenner, S., and Watts-Tobin, R.J., Gen-

eral nature of the genetic code for proteins, Nature 192,

1227–1232 (1961).

Fox,T.D., Natural variation in the genetic code, Annu. Rev. Genet.

21, 67–91 (1987).

Judson, J.F., The Eighth Day of Creation, Expanded Edition, Part

II, Cold Spring Harbor Laboratory Press (1996). [A fascinating

historical narrative on the elucidation of the genetic code.]

Khorana, H.G., Nucleic acid synthesis in the study of the genetic

code, Nobel Lectures in Molecular Biology, 1933–1975, pp.

303–331, Elsevier (1977).

Knight, R.D., Freeland, S.J., and Landweber, L.F., Selection, his-

tory and chemistry: the three faces of the genetic code, Trends

Biochem. Sci. 24, 241–247 (1999).

Nirenberg, M., The genetic code, Nobel Lectures in Molecular Bi-

ology, 1933–1975, pp. 335–360, Elsevier (1977).

Nirenberg, M., Historical review: deciphering the genetic code—a

personal account, Trends Biochem. Sci. 29, 46–54 (2004).

Nirenberg, M. and Leder, P., RNA code words and protein synthe-

sis, Science 145, 1399–1407 (1964). [The determination of the

genetic code by the ribosomal binding of tRNAs using specific

trinucleotides.]

Nirenberg, M.W. and Matthaei, J.H., The dependence of cell-free

protein synthesis in E. coli upon naturally occurring or syn-

thetic polyribonucleotides, Proc. Natl. Acad. Sci. 47, 1588–1602

(1961). [The landmark paper reporting the finding that

poly(U) stimulates the synthesis of poly(Phe).]

Singer, B. and Kusmierek, J.T., Chemical mutagenesis, Annu. Rev.

Biochem. 51, 655–693 (1982).

The Genetic Code, Cold Spring Harbor Symp. Quant. Biol. 31

(1966). [A collection of papers describing the establishment of

the genetic code. See especially the articles by Crick, Niren-

berg, and Khorana.]

Yanofsky, C., Establishing the triplet nature of the genetic code,

Cell 128, 815–818 (2007).

Yarus, M., Caporaso, J.G., and Knight, R., Origins of the genetic

code: the escaped triplet theory, Annu. Rev. Biochem. 74,

179–198 (2005).

Transfer RNA and Its Aminoacylation

Alexander, R.W. and Schimmel, P., Domain–domain communica-

tion in aminoacyl–tRNA synthetases, Prog. Nucleic Acid Res.

Mol. Biol. 69, 317–349 (2001).

Ambrogelly,A., Palioura, S., and Söll,D., Natural expansion of the

genetic code, Nature Chem. Biol. 3, 29–35 (2007).

Björk, G.R., Ericson, J.U., Gustafsson, C.E.D., Hagervall, T.G.,

Jösson,Y.H., and Wikström, P.M.,Transfer RNA modification,

Annu. Rev. Biochem. 56, 263–287 (1987).

Böck,A., Forschhammer, K., Heider, J., and Baron, C., Selenopro-

tein synthesis: an expansion of the genetic code, Trends

Biochem. Sci. 16, 463–467 (1991).

Crick, F.H.C., Codon–anticodon pairing: the wobble hypothesis,

J. Mol. Biol. 19, 548–555 (1966).

Fukai, S., Nureki, O., Sekine, S., Shimada, A., Tao, J., Vassylyev,

D.G., and Yokoyama, S., Structural basis for double-sieve dis-

crimination of

L-valine from L-isoleucine and L-threonine by

the complex of tRNA

Va l

and valyl–tRNA synthetase, Cell 103,

793–803 (2000).

Ibba, M. and Söll, D., Aminoacyl–tRNA synthesis, Annu. Rev.

Biochem. 69, 617–650 (2000).

Ibba, M.A., Francklyn, C., and Cusack, S. (Eds.), The Aminoacyl-

tRNA Synthetases, Landes Bioscience/Eurekah.com (2005).

[Contains reviews on each of the twenty aminoacyl–tRNA

synthetases.]

Jacquin-Becker, C.,Ahel, I.,Ambrogelly,A., Ruan, B., Söll, D., and

Stathopoulos, C., Cysteinyl–tRNA formation and prolyl–tRNA

synthetase, FEBS Lett. 514, 34–36 (2002).

Kim, S.H., Suddath, F.L., Quigley, G.J., McPherson,A., Sussman, J.L.,

Wang, A.M.J., Seeman, N.C., and Rich, A., Three-dimensional

tertiary structure of yeast phenylalanine transfer RNA, Science

185, 435–440 (1974); and Robertus, J.D., Ladner, J.E., Finch, J.T.,

Rhodes, D., Brown, R.S., Clark, B.F.C., and Klug,A., Structure of

yeast phenylalanine tRNA at 3 Å resolution, Nature 250,

546–551 (1974). [The landmark papers describing the high-reso-

lution structure of a tRNA.]

Krzycki, J.A., The direct genetic encoding of pyrrolysine, Curr. Opin.

Microbiol. 8, 706–712 (2005); and Nozawa, K., O’Donoghue, P.,

Gundllapalli, S., Araiso, Y., Ishitani, R., Umehara, T., Söll, D., and

Nureki, O., Pyrolysyl–tRNA synthetase–tRNA

Pyl

structure reveals

the molecular basis of orthogonality, Nature 457, 1163–1167 (2009).

Ling,J., Reynolds, N., and Ibba, M.,Aminoacyl–tRNA synthesis and

translational control, Annu. Rev. Microbiol. 63, 61–78 (2009).

Nureki, O., Vassylyev, D.G., Tateno, M., Shimada, A., Nakama, T.,

Fukai, S., Konno, M., Hendrickson, T.L., Schimmel, P., and

Yokoyama, S., Enzyme structure with two catalytic sites for

double-sieve selection of substrate, Science 280, 578–582

(1998). [The X-ray structures of IleRS in complexes with

isoleucine and valine.]

Rould, M.A., Perona, J.J., and Steitz,T.A., Structural basis of anti-

codon loop recognition by glutaminyl–tRNA synthetase,

Nature 352, 213–218 (1991).

Ruff, M., Krishnaswamy, S., Boeglin, M., Poterszman, A.,

Mitschler, A., Podjarny, A., Rees, B., Thierry, J.C., and Moras,

D., Class II aminoacyl transfer RNA synthetases: Crystal

structure of yeast aspartyl–tRNA synthetase complexed with

tRNA

Asp

, Science 252, 1682–1689 (1991).

Schimmel, P. and Beebe, K., Aminoacyl tRNA synthetases: from

the RNA to the theater of proteins. In Gesteland, R.F., Cech,

T.R., and Atkins, J.F. (Eds.), The RNA World (3rd ed.), pp.

227–255, Cold Spring Harbor Laboratory Press (2006).

Silvian, L.F.,Wang, J., and Steitz,T.A., Insights into editing from an

Ile-tRNA synthetase structure with tRNA

Ile

and mupirocin,

Science 285, 1074–1077 (1999).

Söll, D. and RajBhandary, U.L. (Eds.),tRNA:Structure, Biosynthe-

sis, and Function, ASM Press (1995).

Stadtman, T.C., Selenocysteine, Annu. Rev. Biochem. 65, 83–100

(1996).

REFERENCES

JWCL281_c32_1338-1428.qxd 8/4/10 4:46 PM Page 1424

Ribosomes and Polypeptide Synthesis

Aitken, C.E., Petrov,A., and Puglisi, J.D., Single ribosome dynam-

ics and the mechanism of translation, Annu. Rev. Biophys. 39,

491–513 (2010).

Ban, N., Nissen, P., Hansen, J., Moore, P.B., and Steitz,T., The com-

plete atomic structure of the large ribosomal subunit at 2.4 Å

resolution, Science 289, 905–920 (2000).

Bashan, A. and Yonath, A., Correlating ribosome function with

high-resolution structures,Trends Microbiol. 16, 326–335 (2008).

Bell, C.E. and Eisenberg, D.E., Crystal structure of diphtheria

toxin bound to nicotinamide adenine dinucleotide, Biochem-

istry 35, 1137–1149 (1996).

Brandt, F., Etchells, S.A., Ortiz, J.O., Elcock,A.H., Hartl, F.U., and

Baumeister, W., The native 3D organization of bacterial

polysomes, Cell 136, 261–271 (2009).

Brodersen, D.E., Clemons, W.M., Jr., Carter, A.P., Morgan-

Warren, R.J., Wimberly, B.T., and Ramakrishnan, V.,The struc-

tural basis for the action of the antibiotics tetracycline,

pactamycin, and hygromycin B on the 30S ribosomal subunit,

Cell 103, 1143–1154 (2000).

Czworkowski, J.,Wang, J., Steitz, J.A., and Moore, P.B., The crystal

structures of elongation factor G complexed with GDP, at 2.7

Å resolution; and Ævarsson, A., Brazhnikov, E., Garber, M.,

Zheltonosova, J., Chirgadze, Yu., Al-Karadaghi, S., Svensson,

L.A., and Liljas,A.,Three-dimensional structure of the riboso-

mal translocase: elongation factor G from Thermus ther-

mophilus, EMBO J. 13, 3661–3668 and 3669–3677 (1994).

Dintzis, H.M., Assembly of the peptide chains of hemoglobin,

Proc. Natl. Acad Sci. 47, 247–261 (1961); and The wandering

pathway to determining N to C synthesis of proteins: Some

recollections concerning protein structure and biosynthesis,

Biochem. Mol. Biol. Educ. 34, 241–246 (2006).[The determina-

tion of the direction of polypeptide biosynthesis.]

Dunkle, J.A. and Cate, J.H.D., Ribosome structure and dynamics

during translocation and termination, Annu. Rev. Biophys. 39,

227–244 (2010).

Frank, J., Single-particle imaging of macromolecules by cryo-

electron microscopy, Annu. Rev. Biophys. Biomol. Struct. 31,

303–319 (2002).

Frank, J. and Agrawal, R.K., A ratchet-like inter-subunit reorgan-

ization of the ribosome during translocation, Nature 406,

318–322 (2000).

Frank, J. and Gonzalez, R.L., Jr., Structure and dynamics of a pro-

cessive Brownian motor: the translating ribosome, Annu. Rev.

Biochem. 79, 381–412 (2010).

Gao, H., et al., RF3 induces ribosomal conformational changes

responsible for dissociation of class I release factors, Cell 129,

929–941 (2007).

Gingras, A.-C., Raught, B., and Sonnberg, N., eIF4 initiation fac-

tors: effectors of mRNA recruitment to ribosomes and regula-

tors of translation, Annu. Rev. Biochem. 68, 913–963 (1999).

Held, W.A., Ballou, B., Mizushima, S., and Nomura, M., Assembly

mapping of 30S ribosomal proteins from Escherichia coli, J.

Biol. Chem. 249, 3103–3111 (1974).

Holbrook, S.R., Structural principles from large RNAs, Annu.

Rev. Biophys. 37, 445–464 (2008).

Jackson, R.J., Hellen, C.U.T., and Pestova, T.V., The mechanism of

eukaryotic translation and principles of its regulation, Nature

Rev. Mol. Cell Biol. 10, 113–127 (2010).

Kawashima, T., Berthet-Colominas, C., Wulff, M., Cusack, S., and

Leberman, R.,The structure of the Escherichia coli EF-Tu  EF-

Ts complex at 2.5 Å resolution, Nature 379, 511–518 (1996).

Kiel, M.C., Kaji, H., and Kaji, A., Ribosome recycling, Biochem.

Mol. Biol. Educ. 35, 40-44 (2007); and Hirokawa, G., Demesh-

kina, N., Iwakura, N., Kaji, H., and Kaji, A., The ribosome-

recycling step: consensus or controversy? Trends Biochem. Sci.

31, 143–149 (2006).

Kjeldgaard, M. and Nyborg, J., Refined structure of elongation fac-

tor EF-Tu from Escherichia coli, J. Mol. Biol. 223, 721–742

(1992); and Kjeldgaard, M., Nissen, P.,Thirup, S., and Nyborg, J.,

The crystal structure of elongation factor EF-Tu from Thermus

aquaticus in the GTP conformation, Structure 1, 35–50 (1993).

Korostelev, A. and Noller, H.F., The ribosome in focus: new struc-

tures bring new insights, Trends Biochem. Sci. 32, 434–441

(2007); and Korostelev, A., Trakhanov, S., Laurberg, M., and

Noller, H.F., Crystal structure of the 70S ribosome–tRNA

complex reveals functional interactions and rearrangements,

Cell 126, 1065–1077 (2006).

Laurberg, M., Asahara, H., Korostelev, A., Zhu, J., Trakhanov, S.,

and Noller,H.F.,Structural basis for translation termination on

the 70S ribosome, Nature 454, 852–857 (2008); Korostelev, A.,

Asahara, H., Lancaster, L., Laurberg, M., Hirschi, A., Zhu, J.,

Trakhanov, S., Scott,W.G., and Noller, H.F., Crystal structure of

a translation termination complex formed with release factor

RF2, Proc. Natl.Acad. Sci. 105, 19684–19689 (2008); andWeixl-

baumer, A., Jin, H., Neubauer, C., Voorhees, R.M., Petry, S.,

Kelley, A.C., and Ramakrishnan, V., Insights into translational

termination from the structure of RF2 bound to the ribosome,

Science 322, 953–956 (2008).

Marcotrigiano, J., Gingras, A.-C., Sonenberg, N., and Burley, S.K.,

Cocrystal structure of the messenger RNA 5¿ cap-binding pro-

tein (eIF4E) bound to 7-methyl-GDP, Cell 89, 951–961 (1997).

Moazed, D. and Noller, H.F., Intermediate states in the movement

of transfer RNA in the ribosome, Nature 342, 142–148 (1989).

Moore, P.B. and Steitz,T.A.,The involvement of RNA in ribosome

function, Nature 418, 229–235 (2002); and The structural basis

of large ribosomal subunit function, Annu. Rev. Biochem. 72,

813–850 (2003).

Munro, J.B., Sanbonmatsu, K.Y., Spahn, C.M.T., and Blanchard,

S.C., Navigating the ribosome’s metastable energy landscape,

Trends Biochem. Sci. 31, 390–399 (2009).

Nissen, P., Kjeldgaard, M.,Thirup, S., Polekhina, G., Reshetnikova,

L., Clark, B.F.C., and Nyborg, J., Crystal structure of the ter-

nary complex of Phe–tRNA

Phe

, EF-Tu, and a GTP analog, Sci-

ence 270, 1464–1472 (1995).

Noller, H.F., Hoffarth, V., and Zimniak, L., Unusual resistance

of peptidyl transferase to protein extraction procedures, Sci-

ence 256, 1416–1419 (1992); and Noller, H.F., Peptidyl trans-

ferase: protein, ribonucleoprotein, or RNA? J. Bacteriol. 175,

5297–5300 (1993).

Ogle, J.M., Brodersen, D.E., Clemons,W.M., Jr.,Tarry, M.J., Carter,

A.P., and Ramakrishnan, V., Recognition of cognate transfer

RNA by the 30S ribosomal subunit, Science 292, 897–902

(2001); and Ogle, J.M., Carter, A.P., and Ramakrishnan, V., In-

sights into the decoding mechanism from recent ribosome

structures, Trends Biochem. Sci. 28, 259–266 (2003).

Pioletti, M., et al., Crystal structure of complexes of the small ribo-

somal subunit with tetracycline, edeine and IF3, EMBO J. 20,

1829–1839 (2001).

Rodnina, M.V., Beringer, M., and Wintermeyer, W., How the ri-

bosome makes peptide bonds, Trends Biochem. Sci. 32,

20–26 (2007).

Schluenzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M.,

Janell, D., Bashan,A., Bartels, H.,Agmon, I., Franceschi, F., and

Yonath,A., Structure of functionally activated small ribosomal

subunit at 3.3 Å resolution, Cell 102, 615–623 (2000).

Schmeing, T.M., and Ramakrishnan, V., What recent ribosome

structures have revealed about the mechanism of translation,

References 1425

JWCL281_c32_1338-1428.qxd 8/19/10 10:06 PM Page 1425

Nature 461, 1234–1242 (2009); Simonovic, M. and Steitz, T.A.,

A structural view of the mechanism of the ribosome-catalyzed

peptide bond mechanism, Biochim. Biophys. Acta 1789,

612–623 (2009); and Zimmerman, E. and Yonath,A., Biological

implications of the ribosome’s stunning stereochemistry,

ChemBioChem 10, 63–72 (2009). [Authoritative reviews.]

Schmeing,T.M.,Voorhees, R.M., Kelley,A.C., Gao,Y.-G., Murphy,

F.V., IV,Weir, J.R., and Ramakrishnan,V.,The crystal structure

of the ribosome bound to EF-Tu and aminoacyl–tRNA; and

Gao, Y.-G., Selmer, M., Dunham, M., Weixlbaumer, A., Kelley,

A.C., and Ramakrishnan, V., The structure of the ribosome

with elongation factor G trapped in the post-translocational

state, Science 326, 688–693 and 694–699 (2009).

Selmer, M., Dunham, C.M., Murphy, F.V., IV, Weixlbaumer, A.,

Petry, S., Kelley, A.C., Weir, J.R., and Ramakrishnan,V., Struc-

ture of the 70S ribosome complexed with mRNA and tRNA,

Science 313, 1935–1942 (2006); and Voorhees, R.M., Weixl-

baumer,A., Loakes, D., Kelley,A.C., and Ramakrishnan,V., In-

sights into substrate stabilization from snapshots of the pep-

tidyl transferase center of the intact 70S ribosome, Nature

Struct. Mol. Biol. 16, 528–533 (2009).

Sievers, A., Beringer, M., Rodnina, M.V., and Wolfenden, R., The

ribosome as an entropy trap. Proc. Natl. Acad. Sci. 101,

7897–7901 (2004).

Sonenberg, N., eIF4E, the mRNA cap-binding protein: from basic

discovery to translational research, Biochem. Cell Biol. 86,

178–183 (2008).

Sonenberg, N. and Dever, T.E., Eukaryotic translation initiation

factors and regulators, Curr. Opin. Struct. Biol. 13, 56–63 (2003).

Spahn, C.M.T., Beckmann, R., Eswar, N., Penczek, P.A., Sali, A.,

Blobel, G., and Frank, J., Structure of the 80S ribosome from

Saccharomyces cerevisiae—tRNA-ribosome and subunit-

subunit interactions, Cell 107, 373–386 (2001).

Steitz, J.A. and Jakes, K., How ribosomes select initiator regions in

mRNA: base pair formation between the 3¿ terminus of 16S

RNA and the mRNA during initiation of protein synthesis in

Escherichia coli, Proc. Natl. Acad. Sci. 72, 4734–4738 (1975).

Sykes, M.T. and Williamson, J.R., A complex assembly landscape

for the 30S ribosomal subunit, Annu. Rev. Biophys. 38, 197–215

(2009); and Woodson, S.A., RNA folding and ribosome assem-

bly, Curr. Opin. Struct. Biol. 12, 667–673 (2008).

Vestergaard, B., Van, L.B., Andersen, G.R., Nyborg, J., Bucking-

ham, R.H., and Kjeldgaard, M., Bacterial polypeptide release

factor RF2 is structurally distinct from eukaryotic eRF1, Mol.

Cell 8, 1375–1382 (2001).

Weixlbaumer, A., Petry, S., Dunham, C.M., Selmer, M., Kelley,

A.C., and Ramakrishnan, V., Crystal structure of the ribosome

recycling factor bound to the ribosome, Nature Struct. Mol.

Biol. 14, 733–737 (2007).

Wimberly, B.T., Broderson, D.E., Clemons, W.M., Jr., Morgan-

Warren, R., von Rhein, C., Hartsch, T., and Ramakrishnan, V.,

Structure of the 30S ribosomal subunit, Nature 407, 327–339

(2000); and Broderson, D.E., Clemons, W.M., Jr., Carter, A.P.,

Wimberly, B.T., and Ramakrishnan, V., Crystal structure of the

30S ribosomal subunit from Thermus thermophilus: Structure

of the proteins and their interactions with 16S RNA, J. Mol.

Biol. 316, 725–768 (2002).

Yonath,A.,The search and its outcome:High resolution structures

of ribosomal particles from mesophilic, thermophilic, and

halophilic bacteria at various functional states, Annu. Rev. Bio-

phys. Biomol. Struct. 31, 257–273 (2002).

Yonath, A.,Antibiotics targeting ribosomes: resistance, selectivity,

synergism, and cellular regulation, Annu. Rev. Biochem. 74,

649–679 (2005).

Youngman, E.M., McDonald, M.E., and Green, R., Peptide re-

lease on the ribosome: mechanism and implications for trans-

lational control, Annu. Rev. Microbiol. 62, 33–373 (2008).

Yusupova, G.Z., Yusupov, M.M., Cate, J.D.H., and Noller, H.F.,

The path of messenger RNA through the ribosome, Cell 106,

233–241 (2001).

Control of Eukaryotic Translation

Branch, A.D., A good antisense molecule is hard to find, Trends

Biochem. Sci. 23, 45–50 (1998).

Calkhoven, C.F., Müller, C., and Leutz, A., Translational control of

gene expression and disease, Trends Mol.Med. 8, 577–583 (2002).

Chen, J.-J., and London, I.M., Regulation of protein synthesis by

heme-regulated eIF-2 kinase, Trends Biochem. Sci. 20,

105–108 (1995).

Clemens, M.J., PKR—A protein kinase regulated by double-

stranded RNA, Int. J. Biochem. Cell Biol. 29, 945–949 (1997).

Dever, T.E., Gene-specific regulation by general translation fac-

tors, Cell 108, 545–556 (2002).

Gray, N.K. and Wickens, M., Control of translation initiation in an-

imals, Annu. Rev. Cell Dev. Biol. 14, 399–458 (1998).

Lawrence, J.C., Jr. and Abraham, R.T., PHAS/4E-BPs as regula-

tors of mRNA translation and cell proliferation, Trends

Biochem. Sci. 22, 345–349 (1997).

Lebedeva, I. and Stein, C.A., Antisense oligonucleotides: promise

and reality, Annu. Rev. Pharmacol.Toxicol. 41, 403–419 (2001).

Matthews, M.B., Sonnenberg, N., and Hershey, J.W.B. (Eds.),

Translational Control in Biology and Medicine, Cold Spring

Harbor Laboratory Press (2007).

Mendez, R. and Richter, J.D., Translational control by CPEB: a

means to the end, Nature Rev. Mol. Cell Biol. 2, 521–529 (2001).

Phillips, M.I. (Ed.), Antisense Technology: Part A. General Meth-

ods, Methods of Delivery, and RNA Studies; and Part B. Appli-

cations, Methods Enzymol. 313 and 314 (2000).

Sen, G.C. and Lengyel, P., The interferon system, J. Biol. Chem.

267, 5017–5020 (1992).

Sheehy, R.E., Kramer, M., and Hiatt, W.R., Reduction of poly-

galacturonase activity in tomato fruit by antisense RNA, Proc.

Natl.Acad. Sci. 85, 8805–8809 (1988).

Sonenberg, N. and Hinnebusch, A.G., Regulation of translation

initiation in eukaryotes: mechanisms and biological targets,

Cell 136, 731–745 (2009).

Tafuri, S.R. and Wolffe, A.P., Dual roles for transcription and

translation factors in the RNA storage particles of Xenopus

oocytes, Trends Cell. Biol. 3, 94–98 (1993).

Tamm, I., Dörken, B., and Hartmann, G., Antisense therapy in on-

cology: new hope for an old idea? Lancet 358, 489–497 (2001).

Post-Translational Modification

Gogarten, J.P., Senejani, A.G., Zhaxybayeva, O., Olendzenski, L.,

and Hilario, E., Inteins: structure, function, and evolution,

Annu. Rev. Microbiol. 56, 263–287 (2002).

Harding, J.J., and Crabbe, M.J.C. (Eds.), Post-Translational Modi-

fications of Proteins, CRC Press (1992).

Klabunde, T., Sharma, S., Telenti, A., Jacobs, W.R., Jr., and Sac-

chetini, J.C., Crystal structure of Gyr A protein from Mycobac-

terium xenopi reveals structural basis of splicing, Nature Struct.

Biol. 5, 31–36 (1998).

Liu, X.-Q., Protein-splicing intein: genetic mobility, origin, and

evolution,Annu. Rev. Genet. 34, 61–76 (2000).

Saleh, L. and Perler, F.B., Protein splicing in cis and in trans,Chem.

Rec. 6, 183–193 (2006).

Wold, F., In vivo chemical modification of proteins, Annu. Rev.

Biochem. 50, 783–814 (1981).

1426 Chapter 32. Translation

JWCL281_c32_1338-1428.qxd 9/7/10 2:24 PM Page 1426

Problems 1427

1. What is the product of the reaction of guanine with nitrous

acid? Is the reaction mutagenic? Explain.

2. What is the polypeptide specified by the following DNA

antisense strand? Assume translation starts at the first initiation

codon.

5¿-TCTGACTATTGAGCTCTCTGGCACATAGCA-3¿

*3. The fingerprint of a protein from a phenotypically rever-

tant mutant of bacteriophage T4 indicates the presence of an al-

tered tryptic peptide with respect to the wild type. The wild-type

and mutant peptides have the following sequences:

Mutant

Cys-Glu-Thr- Met-Ser- His-Ser- Tyr-Arg

Wild type

Cys-Glu-Asp-His- Val-Pro-Gln-Tyr-Arg

PROBLEMS

Wold, F. and Moldave, K. (Eds.), Posttranslational Modifications,

Parts A and B, Methods Enzymol. 106 and 107 (1984). [Con-

tains extensive descriptions of the amino acid “zoo.”]

Protein Degradation

Bochtler, M., Ditzel, L., Groll, M., Hartmann, C., and Huber, R.,

The proteasome, Annu. Rev. Biophys. Biomol. Struct. 28,

295–317 (1999).

Brandstetter,H., Kim,J.-S., Groll, M., and Huber,R.,Crystal struc-

ture of the tricorn protease reveals a protein disassembly line,

Nature 414, 466–470 (2001); Walz, J., Tamura, T., Tamura, N.,

Grimm, R., Baumeister, W., and Koster, A.J., Tricorn protease

exists as an icosahedral supermolecule in vivo, Mol. Cell 1,

59–65 (1997); and Walz, J., Koster, A.J., Tamura, T., and

Baumeister, W., Capsids of tricorn protease studied by cryo-

microscopy, J. Struct. Biol. 128, 65–68 (1999).

Cook,W.J., Jeffrey, L.C.,Kasperek,E.,and Pickart,C.M., Structure

of tetraubiquitin shows how multiubiquitin chains can be

formed, J. Mol. Biol. 236, 601–609 (1994).

Cook,W.J., Jeffrey, L.C., Sullivan, M.L., and Vierstra, R.D., Three-

dimensional structure of a ubiquitin-conjugating enzyme (E2),

J. Biol. Chem. 267, 15116–15121 (1992).

DeMartino, G.N. and Gillette,T.G., Proteasomes: machines for all

reasons, Cell 129, 659–662 (2007).

Deshaies, R.J. and Joazeiro, C.A.P., RING domain E3 ubiquitin

ligases, Annu. Rev. Biochem. 78, 399–434 (2009).

Dye, B.T. and Schulman, B.A., Structural mechanisms underlying

posttranslational modification by ubiquitin-like proteins,

Annu. Rev. Biophys. Biomol. Struct. 36, 131–150 (2007).

Finley, D., Recognition and processing of ubiquitin–protein conju-

gates by the proteasome, Annu.Rev.Biochem. 78, 477–513 (2009).

Glickman, M.H. and Ciechanover, A., The ubiquitin-proteasome

proteolytic pathway: destruction for the sake of construction,

Physiol. Rev. 82, 373–428 (2002).

Hershko, A. and Ciechanover, A., The ubiquitin system, Annu.

Rev. Biochem. 67, 425–479 (1998).

Jentsch, S. and Pyrowalakis, G. Ubiquitin and its kin: how close

are the family ties, Trends Cell Biol. 10, 335–342 (2003). [Dis-

cusses Ubls.]

Liu, F. and Walters, K.J., Multitasking with ubiquitin through mul-

tivalent interactions, Trends Biochem. Sci. 35, 352–360 (2010).

Löwe, J., Stock, D., Jap, B., Zwicki, P., Baumeister, W., and Huber,

R., Crystal structure of the 20S proteasome from the archeon T.

acidophilum at 3.4 Å resolution, Science 268, 533–539 (1995);

and Groll, M., Ditzel, L., Löwe, J., Stock, D., Bochtler, M., Bar-

tunik, H.D., and Huber, R., Structure of 20S proteasome from

yeast at 2.4 Å resolution, Nature 386, 463–471 (1997).

Manchado, E., Eguren, M., and Malumbres, M.,The anaphase-pro-

moting complex/cyclosome (APC/C): cell-cycle-dependent and

-independent functions, Biochem. Soc.Trans. 38, 65–71 (2010).

Mukhopadhyay, D. and Riezman, H., Proteosome-independent

functions of ubiquitin in endocytosis and signaling, Science

315, 201–205 (2007).

Navon, A. and Ciechanover, A., The 26S proteosome: from basic

mechanism to drug targeting, J. Biol. Chem. 284, 33713–33718

(2009).

Page, A.M. and Hieter, P.,The anaphase-promoting complex: new

subunits and regulators, Annu. Rev. Biochem. 68, 583–609

(1999).

Pickart, C.M., Back to the future with ubiquitin, Cell 116, 181–190

(2004); and Mechanisms underlying ubiquitination, Annu. Rev.

Biochem. 70, 503–533 (2001).

Schwartz, A.L. and Ciechanover, A., Targeting proteins for de-

struction by the ubiquitin system: implication for human

pathobiology, Annu. Rev. Pharmacol.Toxicol. 49, 73–96 (2009).

Senahdi,V.-J., Bugg, C.E.,Wilkinson, K.D., and Cook,W.J., Three-

dimensional structure of ubiquitin at 2.8 Å resolution, Proc.

Natl.Acad. Sci. 82, 3582–3585 (1985).

Skaug, B., Jiang, X., and Chen, Z.J.,The role of ubiquitin in NF-B

regulatory pathways, Annu. Rev. Biochem. 78, 769–796 (2009).

Sousa, M.C.,Trame, C.B., Tsuruta, H.,Wilbanks, S.M., Reddy, V.J.,

and McKay, D.B., Crystal and solution structures of an HslUV

protease–chaperone complex, Cell 103, 633–643 (2000).

Unno, M., Mizushima, T., Morimoto, Y., Tomisugi, Y., Tanaka, K.,

Yasuoka, N., and Tsukihara, T., The structure of the mam-

malian proteasome at 2.75 Å resolution, Structure 10, 609–618

(2002).

VanDemark, A.P. and Hill, C.P., Structural basis of ubiquitylation,

Curr. Opin. Struct. Biol. 12, 822–830 (2002).

Varshavsky, A., Regulated protein degradation, Trends Biochem.

Sci. 30, 283–286 (2005).

Varshavsky,A.,Turner,G., Du, F., and Xie,Y.,The ubiquitin system

and the N-end rule, Biol. Chem. 381, 779–789 (2000).

Voges, D., Zwickl, P., and Baumeister, W., The 26S proteasome: a

molecular machine designed for controlled proteolysis, Annu.

Rev. Biochem. 68, 1015–1068 (1999).

Wang, J., Hartling, J.A., and Flanagan, J.M., The structure of ClpP

at 2.3 Å resolution suggests a model for ATP-dependent prote-

olysis, Cell 91, 447–456 (1997).

Whitby, F.G., Masters, E.I. Kramer, L., Knowlton, J.R., Yao, Y.,

Wang, C.C., and Hill, C.P., Structural basis for the activation of

20S proteasomes by 11S regulators, Nature 408, 115–120

(2000); and Förster, A.,Whitby, F.G., and Hill, C.P., The pore of

activated 20S proteasomes has an ordered 7-fold symmetric

conformation, EMBO J. 22, 4356–4354 (2003).

Zheng, N., et al., Structure of the Cul1–Rbx1–Skp1–F-box

Skp2

SCF

ubiquitin ligase complex,Nature 41, 703–709 (2002);Schulman,

B.A., et al., Insights into SCF ubiquitin ligases from the struc-

ture of the Skp1–Skp2 complex, Nature 408, 381–386 (2000);

and Zheng, N., Wang, P., Jeffrey, P.D., and Pavletich, N.P., Struc-

ture of a c-Cbl–UbcH7 complex: RING domain function in

ubiquitin-protein ligases, Cell 102, 533–539 (2000).

Zwickl, P., Seemüller, E., Kapelari, B., and Baumeister, W., The

proteasome: A supramolecular assembly designed for con-

trolled proteolysis, Adv. Prot. Chem. 59, 187–222 (2002).

JWCL281_c32_1338-1428.qxd 9/7/10 2:24 PM Page 1427

21. All cells contain an enzyme called peptidyl–tRNA

hydrolase, and cells that are deficient in this enzyme grow very

slowly. What is the probable function of this enzyme and why is

it necessary?

22. An antibiotic named fixmycin, which you have isolated

from a fungus growing on ripe passion fruit, is effective in curing

several types of sexually transmitted diseases. In characterizing

fixmycin’s mode of action, you have found that it is a bacterial

translational inhibitor that binds exclusively to the large subunit

of E. coli ribosomes.The initiation of protein synthesis in the pres-

ence of fixmycin results in the generation of dipeptides that re-

main associated with the ribosome. Suggest a mechanism of

fixmycin action.

23. Heme inhibits protein degradation in reticulocytes by al-

losterically regulating ubiquitin-activating enzyme (E1). What

physiological function might this serve?

24. Genbux Inc., a biotechnology firm, has cloned the gene

encoding an industrially valuable enzyme into E. coli such that the

enzyme is produced in large quantities. However, since the firm

wishes to produce the enzyme in ton quantities, the expense of iso-

lating it would be greatly reduced if the bacterium could be made

to secrete it. As a high-priced consultant, what general advice

would you offer to solve this problem?

1428 Chapter 32. Translation

Aminoacyl–tRNA Dissociation Constant (nM)

Ala–tRNA

Ala

6.2

Gln–tRNA

Ala

0.05

Gln–tRNA

Gln

4.4

Ala–tRNA

Gln

260

Source: LaRiviere, F.J.,Wolfson, A.D., and Uhlenbeck, O.C.,

Science 294, 167 (2001).

Indicate how the mutant could have arisen and give the base se-

quences, as far as possible, of the mRNAs specifying the two pep-

tides. Comment on the function of the peptide in the protein.

4. Explain why the various classes of mutations can reverse a

mutation of the same class but not a different class.

5. Which amino acids are specified by codons that can be

changed to an amber codon by a single point mutation?

6. The mRNA specifying the  chain of human hemoglobin

contains the base sequence

The C-terminal tetrapeptide of the normal  chain, which is spec-

ified by part of this sequence, is

In hemoglobin Constant Spring,the corresponding region of the 

chain has the sequence

Specify the mutation that causes hemoglobin Constant Spring.

7. Explain why a minimum of 32 tRNAs are required to trans-

late the “standard” genetic code.

8. Draw the wobble pairings not in Fig. 32-25a.

9. A colleague of yours claims that by exposing E. coli to

HNO

she has mutated a tRNA

Gly

to an amber suppressor. Do you

believe this claim? Explain.

*10. Deduce the anticodon sequences of all suppressors listed

in Table 32-6 except UGA-1 and indicate the mutations that

caused them.

11. How many different types of macromolecules must be

minimally contained in a cell-free protein synthesizing system

from E. coli? Count each type of ribosomal component as a differ-

ent macromolecule.

12. Why do oligonucleotides containing Shine–Dalgarno se-

quences inhibit translation in prokaryotes? Why don’t they do so

in eukaryotes?

13. Why does m

GTP inhibit translation in eukaryotes? Why

doesn’t it do so in prokaryotes?

14. What would be the distribution of radioactivity in the com-

pleted hemoglobin chains on exposing reticulocytes to

H-labeled

leucine for a short time followed by a chase with unlabeled leucine?

15. Design an mRNA with the necessary prokaryotic control

sites that codes for the octapeptide Lys-Pro-Ala-Gly-Thr-Glu-

Asn-Ser.

*16. Indicate the translational control sites in and the amino

acid sequence specified by the following prokaryotic mRNA.

5¿-CUGAUAAGGAUUUAAAUUAUGUGUCAAUCACGA-

AUGCUAAUCGAGGCUCCAUAAUAACACUU CGAC-3¿

-Ser-Lys-Tyr-Arg-Gln-Ala-Gly-

-Ser-Lys-Tyr-Arg

UCCAAAUACCGUUAAGCUGGA

17. What is the energetic cost, in ATP equivalents, for the E.

coli synthesis of a polypeptide chain of 100 residues starting from

amino acids and mRNA? Assume that no losses are incurred as a

result of proofreading.

18. It has been suggested that Gly–tRNA synthetase does not

require an editing mechanism.Why?

19. Explain why prokaryotic ribosomes can translate a circu-

lar mRNA molecule,whereas eukaryotic ribosomes normally can-

not, even in the presence of the required cofactors.

20. EF-Tu binds all aminoacyl–tRNAs with approximately

equal affinity so that it can deliver them to the ribosome with the

same efficiency. Based on the experimentally determined binding

constants for EF-Tu and correctly charged and mischarged

aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu

recognition system could prevent the incorporation of the wrong

amino acid during translation.

JWCL281_c32_1338-1428.qxd 8/19/10 10:06 PM Page 1428

A77, 1116

AAA



domain, 1184–1185

AAA



family of ATPases, 1197, 1206

AAA



proteins, 1197–1198

AADP



(3-aminopyridine adenine

dinucleotide phosphate), 1125

A antigen, 415

aaRSs, see Aminoacyl-tRNA synthetase

Abasic sites, 1218

Abbé refractometer, 156

AB blood type, 22

ABCA1 (ATP-cassette binding

protein A1), 458

ABC transporters, 766–768, 767F

Abe (abequose), 379F

Abelson, J., 1312, 1351

Abequose (Abe), 379F

A (amyloid- protein), 311–312

A precursor protein (PP), 311–312

Ab initio methods, 305

Abl, 708

A blood type, 22

ABO blood group system, 22, 414–415

Abortive initiation, 1267–1268

Abrin, 1395T

Absolute configuration, 74–75

Absolute rate theory, 484–487

Absorbance:

in Beer–Lambert law, 90

of DNA and nucleic acids, 90, 92, 92F

Absorbance spectrum, 92

AC, see Adenylate cyclase

C (N

-acetylcytidine), 1347F

ACAT, see Acyl-CoA:cholesterol

acyltransferase

ACC (acetyl-CoA carboxylase), 962–964

Accepted names, enzymes, 479

Acceptor, tRNA, 1346

Acceptor control, 862

Accessory pigments, 908–909

Accessory proteins:

G proteins, 692

GroEL/ES system, 294–302

peptidyl prolyl cis-trans isomerases, 292

protein disulfide isomerases, 290–292,

290F, 291F

Accommodation, 1388

ACE (angiotensin converting

enzyme), 547F

ACE inhibitors, 547F

Acetal, 520F

Acetaldehyde, re and si faces, 77F

Acetaminophen, 544–545, 544F, 1000

Acetate, as cholesterol precursor, 975F,

976–977

Acetate ion, 45, 45T, 48F

Acetic acid:

creation in Miller-Urey experiments, 32T

distribution curve, 48, 48F

titration curve, 47, 47F

Acetimidoquinine, 544–545, 544F

Acetoacetate, 959, 960F

decarboxylation, 510–511

and degradation of leucine/lysine,

1040–1041

and degradation of

phenylalanine/tyrosine, 1043–1047

degradation of tryptophan, 1041–1042

Acetoacetyl-CoA, 960

-Aceto--hyroxybutyrate, 1075

Acetolactate, 1075

Acetone, 959

and cell wall lysis, 130

dielectric constant and dipole

moment, 43T

protein solubility in, 134

Acetonel, 679F

Acetonyl-CoA, 806–807

Acetylcholine (ACh), 527, 778–780

Acetylcholine receptor (AChR),

780–781, 780F

Acetylcholinesterase, 781–782, 782F

diffusion-limited, 490, 491

inactivation by DIPF, 527

Michaelis–Menten kinetic constants, 489T

Acetyl-CoA, 561, 561F

in citric acid cycle, 789, 792–796, 792F,

795F, 816–819

and degradation of leucine/lysine,

1040–1041

and integration of pathways, 1090

in ketogenesis, 960–961, 960F

pyruvate carboxylase regulation, 873–874

Acetyl-CoA acetyltransferase, 960–961

Acetyl-CoA carboxylase (ACC), 962–964

Acetyl-coenzyme A, see Acetyl-CoA

-Acetylcytidine (ac

C), 1347F

N-Acetyl-D-galactosamine, 392F

Acetyl-dihydrolipamide-E2, 795

N-Acetylglucosamine, see NAG

N-Acetylglutamate, 1025, 1029, 1070F, 1071

N-Acetylglutamate-5-semialdehyde,

1070F, 1071

N-Acetylglutamate synthase, 1029,

1070F, 1071

N-Acetylimidazolium, 513

ε-N-Acetyllysine, 79F

N-Acetylmuramic acid, see NAM

N-Acetylneuraminic acid, see NANA

N-Acetylneuraminidate, 392F

Acetyl phosphate, 580, 607

Acetylsalicylic acid, 998

N-Acetylserine, 79F

O-Acetylserine, 1071

Acetyl transferase (AT), 967, 968

N-Acetylxylosamine (XylNAc) residue, 523

ACh, see Acetylcholine

AChR, see Acetylcholine receptor

Acids, 45

dissociation constants, 45–47, 46T

polyprotic, 48–50, 49F

Acid-base buffers, 48

Acid-base catalysis, 506–510

Acid-base indicators, 51

Acid-base reactions, 45–47

and amino acids, 72–73

for protein assays, 131

and standard state conventions, 60

Acid chain hypothesis, 446

Acidic solutions, 47

Acidosis, 955

Ackee fruit, 948

Ackers, G., 353

Aconitase, 789, 790F, 808–809, 808F

cis-Aconitate, 789

ACP (acyl-carrier protein), 961

ACP synthase, 961

Acquired immune deficiency syndrome,

see AIDS

Acridine orange, 157

Acromegaly, 685

Acrosomal protease, 525T

Acrylamide, 147, 147F

ACTH, see Adrenocorticotropic hormone

Actin, 10, 10F, 301, 857

in erythrocyte membranes, 413F, 414

helical symmetry, 269

Actinomycin D, 79, 1272, 1272F

Action potentials, 775–777, 775F, 776F

Activated complex, 485

Activation barrier, 486

Activators, 96, 351

Active, rolling mechanism (DNA

unwinding), 1185–1186, 1186F

Active transport, 420, 747

ATP-driven, 758–768

ion-driven, 768–771

Activity, 59–61

Activity coefficient, 61

Acute intermittent porphyria, 1056

Acute lymphoblastic leukemia, 1034

Acute pancreatitis, 537

Acyl-carnitine, 946

Acyl-carrier protein (ACP), 961

Acyl-CoA:cholesterol acyltransferase

(ACAT), 455, 984

Acyl-CoA dehydrogenase, 948F

I-1

INDEX

Page references in bold face refer to a major discussion of the entry. Positional and configurational designations in chemical

names (e.g., 3-, , N-, p-, trans, D-, sn-) are ignored in alphabetizing. Numbers and Greek letters are otherwise alphabetical as if

they were spelled out.

Note: Chapters 33–35, which are only available on our book companion website, www.wiley.com/college/voet, are separately

indexed at this website.



JWCL281_ndx_I1-I53.qxd 10/28/10 12:02 PM Page I-1

I-2 Index

Acyl-CoA dehydrogenase (AD), 947, 948

Acyl-CoA oxidase, 958

Acyl-CoA synthases, 945–946

Acyl-dihydroxyacetone phosphate, 971

1-Acyldihydroxyacetone phosphate, 1007

Acyl-enzyme intermediate, 533

2-Acylglycerol, 941

1-Acylglycerol-3-phosphate acyltransferase,

971

Acyl group transfer, 565

Acyl phosphates, 580

N-Acylsphingosine phosphocholine, 1008

Acyltransferase (AT), 968

AD, see Acyl-CoA dehydrogenase;

Alzheimer’s disease

ADA, see Adenosine deaminase

ada gene, 1216

Adair, G., 348

Adair constants, 349

Adair equation, 348–349

Ada protein, 1216

Adapter proteins, see APs

Adaptive enzymes, 1261

Adaptor, 705–711, 709

Adaptor hypothesis, 1345

ADAR1, 1150–1151, 1150F

and RNA editing, 1322–1323, 1323F

ADAR2:

and RNA editing, 1322, 1323F

Addison’s disease, 681

Adducin, 412F–413F

Ade, see Adenine

Adenine, 18, 83, 83T. See also Watson-Crick

base pairs

and genetic code, 100T, 1343T

IR spectra of derivatives, 1155F

modified nucleosides of, 1347F

and point mutations, 1339–1340

Adenine phosphoribosyltransferase

(APRT), 1114

Adenohypophysis, 682

Adenosine, 83T, 578, 1130F

Adenosine-3¿,5¿-cyclic monophosphate,

see cAMP

Adenosine-5¿-(-amino) diphosphate

(AMPPN), 763, 763F

Adenosine-5¿-(,-imido) triphosphate,

see AMPPNP

Adenosine-5¿-(,-methylene) triphosphate

(AMPPCP), 763, 763F, 764

Adenosine-5¿-phosphosulfate, 183

Adenosine-5¿-phosphosulfate (APS)

kinase, 1072

Adenosine deaminase (ADA), 1130F, 1131

Adenosine diphosphate, see ADP

Adenosine monophosphate, see AMP

Adenosine triphosphate, see ATP

S-Adenosylhomocysteine, 1034

S-Adenosylmethionine, see SAM

Adenyl-3¿,5¿-uridyl-3,¿5¿-cytidyl-3,¿5¿-

guanylyl-3¿-phosphate, 84F

Adenylate cyclase (AC), 653, 697–698, 1286

Adenylate kinase (AK), 582

and glycolysis control in muscle,

627–628, 628F

X-ray structure of porcine, 254, 255F

Adenylic acid, see AMP

Adenylosuccinate, 1112

Adenylosuccinate lyase (PurB), 1109F,

1111, 1112

Adenylosuccinate synthetase, 1112F

Adenyltransferase, 1069, 1071

ADH, see Alcohol dehydrogenase;

Antidiuretic hormone

Adhesins, 382

Adipocytes, 388–389, 388F, 1096, 1097F

Adiponectin, 1096, 1097F

Adiponectin receptors, 1096

Adipose tissue, 389

brown, 860

glucose uptake regulation in, 751F

and other organs, 1091F, 1093

A-DNA, 1146F, 1147F, 1148–1149, 1148T, 1151

AdoCbl, see 5¿-Deoxyadenosylcobalamin

AdoMet, see SAM

ADP (adenosine diphosphate), 17, 82

in Calvin cycle, 931

in catabolism, 561, 561F

in citric acid cycle, 816–817

in glycolysis, 594F, 595

in GroEL/ES system, 295–302

RuvB binding of, 1231

and thermodynamics of life, 578–583

ADP/ATP carrier, 771

ADP-glucose, 645

ADP-glucose pyrophosphorylase, 931

ADPNP, see AMPPNP

ADP-ribosylated diphthalamide residue,

eEF2, 1398

ADP-ribosylation, 1398

ADP-ribosylation factor, see ARF1

Adrenal glands, 672F

Adrenaline, see Epinephrine

-Adrenergic receptors, 664, 680

Adrenocortical steroids, 680

Adrenocorticotropic hormone (ACTH),

673T, 682–683

Adrenoleukodystrophy (ALD), 767, 958

-Adrenoreceptors, 660, 680

Adriamycin, 1169

Adsorption chromatography, 132T, 135,

143–144

Adult-onset diabetes, 1102–1103

Aequorea victoria, 120

Aerobes, 6. See also specific organisms

Aerobic fermentation, 594F

Aerobic metabolism, 864–865

Aerobic oxidation, 594F

Affinity chromatography, 132T

ion exchange, 136

metal chelation, 145

mRNA, 158

for proteins, 118, 141–143, 141F

Affinity labeling, 527

Aflatoxin B

, 1225

AFM (atomic force microscopy), 376

Africa, sickle-cell anemia in, 188, 343

African clawed toad, 1202

African sleeping sickness, 799

Agard, D., 456

Agarose gel electrophoretogram, 106F

Agarose gels:

in affinity chromatography, 142, 142F

in gel electrophoresis, 147–149

in gel filtration chromatography,

139, 140T, 141

in ion exchange chromatography, 137

AGC family of protein kinases, 730



gene, 1261–1262, 1264

a gene (fruit fly), 25F

Agglutinin, 366

Aggrecan, 373–375, 373T, 374F

Aging, telomere length and, 1210–1211

Aglycone, 366

AGO, see Argonaute

Agonist, 539, 680

Agouti related peptide (AgRP), 1099

Agrin, 373T

Agrobacterium radiobacter, 106F

AgRP (agouti related peptide), 1099

AICAR, see 5-Aminoimidazole-4-

carboxamide ribotide

AICAR transformylase (PurH), 1109F, 1111

AIDS (acquired immune deficiency

syndrome), 123, 545–546. See also HIV

AIR, see 5-Aminoimidazole ribotide

AIR carboxylase, 1109F, 1111

AIR synthetase (PurM), 1109F, 1110

AK, see Adenylate kinase

AKAPs (A-kinase anchoring proteins), 714

Akey, C., 424

A-kinase anchoring proteins (AKAPs), 714

Akt, see Protein kinase B

Akt1/PKB, 734

Akt2/PKB, 734

Akt3/PKB, 734

Ala, see Alanine

ALA (-aminoleuvulinic acid), 1048

ALAD (-aminoleuvulinic acid

dehydratase), 1048

Alanine:

biosynthesis, 1067–1073

degradation of, 1030–1034

and degradation of tryptophan,

1041–1042

genetic codes for, 100T, 1343T

half-life, 1413T

 helix/ sheet propensity, 302T, 304

hydropathy scale for, 264T

in Miller-Urey experiments, 32T

in native unfolded proteins, 283

nonessential amino acid, 1065T

nonpolar side chain, 70

Ramachandran diagram, 224F, 225

structure and general properties, 68T, 71F

(S)-Alanine, 76, 77F

-Alanine:

creation in Miller-Urey experiments, 32T

in pyrimidine catabolism, 1136

L-Alanine, 76, 77F

Alanine tRNA, 176, 1345

AlaRS, 1351

ALAS-1, 1056

ALAS-2, 1056

ALA synthase, 1056

Ala-tRNA

Cys

, 1359

Albumin, 154F, 542, 677. See also

Serum albumin

Alcaptonuria, 569

Alcohols:

effect on protein denaturation, 265

reactions to form hemiacetals and

hemiketals, 361F

Alcohol dehydrogenase (ADH), 479

in fermentation, 618–619

and methanol oxidation, 505

molecular mass of, 140F

stereospecificity of, 470–473

Alcoholic fermentation, 470, 593–594,

616–619, 616F

Alcohol:NAD



oxidoreductase, 479

ALD, see Adrenoleukodystrophy

Aldehydes, hemiacetal formation of, 361F

Aldehyde dehydrogenase, 447F

Alditols, 364

Aldohexoses, 360F

Aldolase, 568

binding to erythrocyte membrane, 412

in glycolysis, 596F, 600–603, 600F, 602F

half-life, 1408T

molecular mass determination by gel

filtration chromatography, 140F

sedimentation coefficient, 154F

Aldol condensation, 568

Aldol histidine, 239F

JWCL281_ndx_I1-I53.qxd 10/28/10 12:02 PM Page I-2