Goldfarb D. Biophysics DeMYSTiFied

Подождите немного. Документ загружается.

152 BiophysiCs D e mystifieD

Fatty Acids

Fatty acids are long chain hydrocarbons with a carboxyl (carboxylic acid) group

at one end. Fatty acids can be characterized in terms of the number of carbon

atoms in the chain, which is typically from12 to 20 carbon atoms. Fatty acids

are also characterized in terms of whether any double bonds exist in the hydro-

carbon chain and, if so, where the double bonds are in the chain.

Fatty acids that have no double bonds are called saturated fatty acids. This is

because with no double bonds, the carbon atoms are able to covalently bond to

the maximum number of hydrogen atoms. Thus they are saturated with hydro-

gen atoms. As explained, carbon atoms form four covalent bonds. A carbon

atom in the middle of the chain can bond to at most two hydrogen atoms, since

it is also bonded to two other carbon atoms (one on each side in the chain). The

carbon atom at the end of the chain is covalently bonded to three hydrogen

atoms, since it is connected to only one other carbon atom.

When a carbon atom is double-bonded with another atom, then the double

bond counts as two of the four covalent bonds that the carbon atom can form.

If the double-bonded carbon atom is in the middle of chain, then it can bond

with only one hydrogen atom, since it otherwise has a double bond on one side

and a single bond on the other. If the double-bonded carbon is at the end of the

chain, then it can only have two hydrogen atoms directly attached to it, instead

of its usual three. Fatty acids that contain double bonds are called unsaturated,

because it is possible (through chemical processes) to add hydrogen atoms to

the molecule by converting the double bonds to single bonds. Fatty acids with

more than one double bond in the carbon chain are called polyunsaturated.

Glycerides

Glycerol is a small, three-carbon carbohydrate. Glycerol can be derived from a

saturated, three-carbon hydrocarbon chain by replacing one hydrogen atom on

each of the three carbon atoms with a hydroxyl group. See Fig. 7-10. (Glycerol

is also called glycerin or glycerine; all three terms refer to the same molecule.)

Figure 7-10 • Structural formula for a

glycerol molecule, a carbohydrate that serves

as the foundation for lipids known as

glycerides.

Chapter 7 BiomoleCules 101 153

Glycerol serves as the foundation for a class of lipids known as glycerides. Glyc-

erides are formed by combining one, two, or three fatty acids with the glycerol

molecule, resulting in a monoglyceride, diglyceride, or triglyceride.

Triglycerides play an important role in energy storage in many organisms, as

well as in dietary intake of lipids. When a fatty acid combines with glycerol, the

hydrogen atom on one of the glycerol hydroxyl groups is replaced by a covalent

connection to the carboxylic carbon of the fatty acid. At the same time, the

fatty acid loses its hydroxyl group. (The lost hydroxyl group combines with the

hydrogen atom from glycerol to form a water molecule.) The result is an ester

functional group attaching the glycerol to the fatty acid hydrocarbon chain. An

ester is a type of carbonyl group very similar to carboxyl, but where the hydroxyl

hydrogen or the carboxyl group has been replaced with a carbon atom. That

carbon atom in turn may be attached further to other atoms in the molecule.

Figure 7-11 shows an example of a triglyceride. Notice the oxygen atom

between the carbonyl carbon and the glycerin portion of the molecule.

Phospholipids

A phospholipid is class of lipid consisting of phosphate group attached to a dig-

lyceride. The attachment is via the diglyceride’s third glycerol hydroxyl group.

This hydroxyl group is replaced by a covalent bond to one of the phosphate

oxygen atoms. Typically the other side of the phosphate is attached to some

other small organic molecule or functional group. Figure 7-12 shows as an

example the phospholipid phosphatidylcholine, where the small molecule cho-

line is attached to the phosphate. A single type of phospholipid such as phos-

phatidylcholine can represent a whole set of phospholipids depending on which

specific fatty acid side chains are attached.

Figure 7-11 • A triglyceride is a glycerin

molecule attached to three fatty acids. The

carboxylic acid functional group has lost its

hydroxyl hydrogen and replaced it with a covalent

bond to the glycerin molecule. In this way the

carboxylic acid group has become an ester.

(Courtesy of Biochemistry Demystified.)

154 BiophysiCs DemystifieD

Phospholipids are a major component of cell membranes. The phosphate

“head” of phospholipids is very hydrophilic, while the hydrocarbon “tails” are

hydrophobic. The amphipathic character of phospholipids makes them ideal

for membrane construction.

Nonpolymeric Lipids

Nonpolymeric lipids are lipids that are not polymers or do not contain polymers

as a major portion of their structure. They are also called nonsaponifiable lipids,

(a)

Choline

(b)

Phosphatydl choline

Figure 7-12 • A choline molecule (top), and

the phospholipid phosphatidylcholine (bottom).

Chapter 7 BiomoleCules 101 155

meaning that they cannot be broken down by the chemical process of hydro-

lysis. Nonpolymeric lipids typically include one or more ring structures. Exam-

ples of nonpolymeric lipids include the steroids (such as cortisone and

vitamin D). Other examples include vitamins A, E, and K which are part of a

class of molecules known as terpenes. Probably the most famous of nonpoly-

meric lipids is cholesterol, which is a sterol, a combination of a steroid and an

alcohol. See Fig. 7-13. Cholesterol plays an important role in the cell mem-

brane. It is amphipathic. Its hydroxyl group can bind to the hydrophilic portion

of phospholipids, and its relatively stiff hydrophobic rings lend rigidity to the

hydrophobic portion of cell membranes.

Proteins

A protein is a polymer of amino acids, so to understand what a protein is, one

first needs to understand what an amino acid is. An amino acid is a molecule

that has a carbon atom with an amine group on one side and a carboxyl group

on the other. This carbon atom is called the a-carbon (alpha carbon) to distin-

guish it as the place where the amine and carboxyl groups are attached. Since

carbon atoms typically form four covalent bonds, that leaves two more covalent

bonds for the a-carbon. One of those two bonds is formed with hydrogen. The

other is formed with a group of atoms called the amino acid side chain. The side

chain can vary greatly from one amino acid to another. The word chain in this

context is not meant to imply a linear chain (as it did in the case of a hydrocar-

bon chain). Rather an amino acid side chain is simply a group of a few to about

20 or so atoms making up a specific structure. We call it a side chain by conven-

tion, because it hangs from the part of the molecule that defines the molecule

as an amino acid. See Fig. 7-14.

There are 20 different major amino acids found in living things, each with its

own characteristic side chain. Some side chains are hydrophobic. Some are

Figure 7-13 • Cholesterol.

156 BiophysiCs DemystifieD

hydrophilic. Some are amphipathic. From this group of 20 amino acids, organisms

build literally thousands and thousands of different proteins. The extremely large

number of different proteins is possible because, like the letters in an alphabet

used to form words and sentences, organisms can link together various amounts

of 20 different amino acids in various orders to form proteins. When you consider

that any given protein can contain anywhere from 15 or so amino acids, to hun-

dreds or even thousands of amino acids, linked together in various arrangements,

the number of possible combinations is enormous. The number of different pro-

teins is analogous to the number of different sentences, or perhaps even the

number of different paragraphs, one could possibly write given an alphabet.

When amino acids are connected together to form a polymer, the carboxyl

group of one amino acid connects to the amine group of the next amino acid.

The process is similar to what we saw above when connecting the carboxyl of

a fatty acid to glycerol. In the amino acid case, a hydrogen atom from the amine

breaks away and combines with the hydroxyl group from the carboxyl, which

also breaks away. These two combine to form a new water molecule. At the

same time a covalent bond is formed between the carbonyl carbon of one

amino acid and the amine nitrogen of another. This bond is called a peptide

bond. For this reason, proteins are also called polypeptides. Figure 7-15 illustrates

the formation of a peptide bond between two amino acids.

Figure 7-14 • Structure of an amino acid.

(Courtesy of Biochemistry Demystified.)

Figure 7-15 • Formation of a peptide bond connecting two amino

acids. (Courtesy of Biochemistry Demystified.)

Chapter 7 BiomoleCules 101 157

Protein Structure and Function

Proteins exhibit primary, secondary, tertiary, and quaternary structures (as was

discussed in Chap. 2). Once a polypeptide is formed, the primary structure or

sequence of amino acids in the polymer bends, twists, and folds, until the pro-

tein takes on a particular shape. One of the big questions in biophysics is how

can we predict the structure, and possibly function, of a protein from the

knowledge of its amino acid sequence. When proteins fold into shape, the most

favorable shape is the one that minimizes contact between hydrophobic and

hydrophilic amino acids. In aqueous solution, as a general rule, the hydrophobic

parts of the protein will tend to be folded into the center of the molecule,

shielded by the hydrophilic portions of the protein which have more direct

contact with water.

Proteins are the worker bees of life. Proteins take part in nearly every process

in living organisms. They regulate biophysical processes, they generate move-

ment, they are essential for nerve signals, they provide structural support, and

they transport other molecules from place to place.

Proteins are most famous for catalyzing (increasing the rate of) biochemical

reactions. A catalyst is a substance that modifies the rate of a chemical reaction,

without actually being consumed by the reaction. Proteins that act as catalysts

are called enzymes. The rate of nearly every biochemical process is controlled

by enzymes. One cannot overstate the importance of the role of proteins as

enzymes. Even the organism’s manufacture of a single protein (or other biomol-

ecule) involves the work of many different proteins acting as enzymes.

In addition to controlling the rate of biochemical reactions, proteins are very

much involved in other ways in the control or regulation of biological processes.

For example, proteins bind to other molecules, and through that binding they

either encourage or hinder various biophysical processes. The binding is typi-

cally through a set of hydrogen bonds and salt bridges between the protein and

the other molecule. There are many mechanisms through which binding affects

biophysical processes, including steric hindrance (getting in the way) and stabi-

lizing a particular conformation of the molecule.

Proteins play a major role in the immune system too. Antibodies, also called

immunoglobulins, are proteins that can recognize and bind to foreign objects

(such as viruses and bacteria). In this way they help neutralize the threat from

foreign objects and prevent them from harming the organism.

Proteins are involved in transport of other molecules. For example, the pro-

tein hemoglobin transports oxygen from the lungs to every cell in the body.

Similarly lipoproteins carry lipids to where they are needed, often carrying them

158 BiophysiCs DemystifieD

through places where the lipids would otherwise (without the protein) be

insoluble (e.g., through the bloodstream). Proteins also help transport ions and

other small molecules through cell membranes.

Proteins play a structural role as well. Examples include holding DNA

together in chromosomes (see the section Nucleic Acids that follows), forma-

tion of hair, fingernails, and muscles, and formation of the cytoskeleton, a fibrous

protein network that helps cells maintain their shape. Proteins also provide

movement; for example, muscle contraction is a direct result of the action of

proteins, as is movement of the cytoskeleton.

Nucleic Acids

Nucleic acids are biomolecules named for being an acidic substance (one that

increases the concentration of H

ions) originally discovered in the nucleus (cen-

ter compartment) of cells. Nucleic acids play a number of roles in life, including

storage and expression of genetic information, transport of amino acids during

protein synthesis (manufacture), and in some cases even acting as catalysts.

Nucleic acids are polymers of nucleotides. A nucleotide is molecule that has

the following three parts to it: (1) a nitrogenous base (also called a nucleotide

base) which is any one of certain aromatic ring compounds containing nitrogen,

(2) a sugar (ribose or deoxyribose), and (3) one to three phosphate groups.

There are five main nitrogenous bases found in nucleic acids. Small amounts

of other nucleotide bases do occur, but they are far less common and so will not

be discussed here. The five main nucleotide bases fall into two categories:

pyrimidines and purines. The pyrimidines are so named because they are all

similar to the molecule pyrimidine which is an aromatic ring containing four

carbon and two nitrogen atoms. (See Fig. 7-16a.) The pyrimidines include cyto-

sine, thymine, and uracil. In contrast to pyrimidines, a purine contains two rings;

one is a five-atom ring with two nitrogen atoms, the other is a six-atom pyrimi-

dine ring. The purine’s two rings are covalently attached to one another in a

way such that they share two carbon atoms. That is, two carbon atoms are part

of both rings. (See Fig. 7-16b.) The purines include adenine and guanine.

The sugar within the nucleotides is either ribose or deoxyribose. Both are five-

carbon carbohydrates, in ring form (actually strictly speaking the deoxy form is a

carbohydrate derivative, as mentioned earlier in this chapter). Figure 7-17 shows

the skeletal formula for ribose and deoxyribose. Nucleic acids that contain ribose

are called ribonucleic acids, abbreviated RNA, and nucleic acids containing deoxy-

ribose are called deoxyribonucleic acid, or DNA. There are a number of differences

Chapter 7 BiomoleCules 101 159

between RNA and DNA, but the two main differences that you should remem-

ber are (1) RNA contains the sugar ribose, whereas DNA contains deoxyribose

and (2) in RNA we find the nucleotide base uracil (but generally not thymine),

whereas in DNA we find thymine (but not uracil).

Within nucleic acids, the nucleotides have only one phosphate group. How-

ever, nucleotides play other biological roles, outside of nucleic acids, in which

they sometimes have two or three phosphate groups in a row.

Figure 7-16 • The nucleotide bases. There are five

main nucleotide bases found in nucleic acids. They are

divided into two main categories: (a). Pyrimidines,

including cytosine, thymine, and uracil. (b) Purines,

including adenine and guanine. (Courtesy of Biochemistry

Demystified.)

(a)

(b)

Adenine

Guanine

(a)

(b)

Figure 7-17 • (a) Ribose. (b) Deoxyribose.

160 BiophysiCs DemystifieD

When nucleotides polymerize to form a nucleic acid, the sugar from one

residue covalently attaches to the phosphate from the next residue, and so on.

The resulting nucleic acid polymer consists of a backbone of alternating sugar

and phosphate residues, with the nitrogenous bases covalently attached to, and

hanging off the side of, the sugar residues. See Fig. 7-18.

Nucleic Acid Structure

Nucleic acids (DNA and RNA) exhibit a number of primary, secondary, ter-

tiary, and even quaternary structures that will be discussed in some detail in a

later chapter. Here we will provide a brief review of some of the common

structural features of nucleic acids.

Figure 7-18 • An example of a four-residue DNA polymer.

(Adapted from Wikimedia Commons.)

Chapter 7 BiomoleCules 101 161

The primary structure of nucleic acids is the specific nucleotide sequence

making up the polymer. When discussing primary structure in DNA and RNA,

we abbreviate the nucleotides using the first letter from the name of the nitrog-

enous base, in upper case. That is, we use A, T, C, G, and U, respectively for

adenine, thymine, cytosine, guanine, and uracil. Figure 7-19 shows, as an exam-

ple, the nucleotide sequence for a portion of an RNA molecule known as phe-

nylalanine transfer RNA. Phenylalanine is an amino acid. Phenylalanine transfer

RNA (abbreviated tRNA

Phe

) is a ribonucleic acid involved in transporting phe-

nylalanine to where it is needed for protein synthesis (manufacture).

Nucleic acid secondary structures tend toward a helical shape, largely due to

aromatic stacking interactions (see Chap. 6) among the nitrogenous bases. Bio-

physicists use the phrase base stacking, when referring specifically to the stack-

ing interactions of nitrogenous bases in nucleic acids, but it is the same aromatic

stacking discussed in Chap. 6.

Nucleic acids form both single-stranded and double-stranded polymers. Both

are helical structures. In the case of double-stranded nucleic acids, the second-

ary structure is the famous double helix. The double-stranded structure comes

about through a process known as base pairing, in which the nitrogenous bases

from one strand line up and hydrogen bond with the bases from another strand.

The process is called base pairing because the nucleotide structures are such

that each nucleotide only hydrogen-bonds in a stable way with a certain other

nucleotide, its pair nucleotide. Guanine pairs only with cytosine. In DNA,

adenine pairs with only thymine. In RNA, adenine pairs with uracil. Figure 7-20

shows hydrogen bonding between base pairs.

The helical secondary structure is due to base stacking interactions, rather than

hydrogen bonding. This is true for both single-stranded and double-stranded

nucleic acids. The double-stranded form, however, requires hydrogen bonding

between the bases of each strand in order to form a stable double helix. And

hydrogen bonding between nucleotide bases requires the specific base pairings as

mentioned. Therefore stable double-stranded nucleic acids can occur only if the

ACCACGCUUAAGACACCUAGC

Figure 7-19 • A portion of the nucleotide

sequence from a molecule of phenylalanine

transfer RNA (a ribonucleic acid). When

specifying the nucleotide sequence (primary

structure) of a nucleic acid, we abbreviate using

the first letter of each nucleotide base: A, T, C,

G, and

u, respectively for adenine, thymine,

cytosine, guanine, and uracil.