Goldfarb D. Biophysics DeMYSTiFied

Подождите немного. Документ загружается.

222 Biophysics D emystifieD

Introduction

The first thing to understand from a biophysics point of view is that DNA is more

than a storehouse of genetic information, more than just a book of instructions

to be read for building proteins. True, sequences of nucleotides in DNA are tran-

scribed and translated into sequences of amino acids in proteins. But the sequences

of nucleotides in DNA and RNA do more than just specifing the order of amino

acids in proteins. For one thing, the nucleotide sequence of a nucleic acid has a

major impact on secondary and tertiary structures, which in turn play an essential

role in genetic functioning. Nucleotide sequence also influences the Gibbs energy

of helix formation, affecting the winding and unwinding of the DNA double

helix, which is necessary for transcription and replication. And sections of nucle-

otide sequence may define binding sites so that certain proteins will bind to the

nucleic acid only where that specific nucleotide sequence exists.

DNA Secondary Structure

Let’s start by taking a look at a space-filling model for the DNA double helix.

Figure 10-1 shows a space-filling model for the B form of DNA double helix.

B-DNA is the classic double helix proposed by Watson and Crick. The B-DNA

double helix itself is characterized by the following properties. The width of the

helix is 23.7 Å (1 Å 5 1 angstrom 5 10

210

m). The pitch of the helix (the length

of one turn of the helix) is 33.2 Å. Each turn of the B-DNA double helix con-

tains about ten base pairs. Combined with the pitch of the helix, this means

that there is a distance of about 3.3 Å from each base pair to the next.

There are a few other points to note about the DNA double helix. First, in

contrast to the alpha helix of proteins, the backbone of the DNA double helix

is on the outside of the helix. The backbone here consists of a repeating sequence

of alternating sugar and phosphate residues. In nucleic acid double-helical con-

formations, the base pairs are on the inside of the helix, with the sugar-phosphate

backbones on the outside. Also, strictly speaking there are two backbones in a

double helix, one from each nucleotide strand.

Another thing to note is that there are two helical grooves that wind around

the helix, between where the backbones stick out. One grove is about 50%

wider than the other, and thus they are called the major groove and the minor

groove. The major groove is particularly important because it somewhat exposes

the interior of the helix; this benefits proteins and other molecules that need

to bind to a specific sequence of nucleotides. The major groove allows these

molecules to “see” the nucleotide sequence on the inside of the double helix.

chapter 10 Nucleic Acid Biophysics 223

Current evidence indicates that B-DNA is the most common DNA double-

helix conformation in nature, but other conformations of double helix exist too.

The most studied double-helix conformations (other than B-DNA) are A-DNA

and Z-DNA, which differ from B-DNA in their helical pitch, tilt of their base

FIgure 10-1 • DNA double helix in the B-form

conformation.

224 Biophysics DemystifieD

pairs, and so on. Z-DNA is also different because it is a left-handed helix, which

means that as you move along the length of the helix, the helix turns in a coun-

terclockwise direction (as opposed to a right-handed helix, in which the helical

turns are in a clockwise direction).

Table 10-1 lists various parameters which distinguish the different double

helix conformations for A-, B-, and Z-DNA. You can also see, in Fig. 10-2,

space-filling models for A- and Z-DNA, which can be compared with that for

B-DNA in Fig. 10-1. Notice that the relative sizes of the major and minor

groove are different. The Z-DNA conformation, in addition to being left-

handed, is a much tighter conformation, resulting in a narrower helix and more

base pairs per turn. The data listed in Table 10-1 are for crystalline (solid) DNA.

Direct conformational measurements are best obtained using X-ray diffraction

which requires molecules to be crystallized. However, experiments with DNA

in solution indicate that the helical repeat for B-DNA in solution is about 10.4

base pairs per turn of the helix. This would mean that the base pairs are slightly

closer together in solution than they are in the DNA crystal.

TABLE 10-1 Some geometric parameters describing the A-, B-, and Z- conformations

of DNA double helix.

Geometric Parameter B-DNA A-DNA Z-DNA

Pitch of helix (length of one turn) 33.2 Å 24.6 Å 45.6 Å

Width of helix 23.7 Å 25.5 Å 18.4 Å

Average base pairs per turn of helix 10.0 10.7 12

The A-form double helix is also the conformation observed for RNA-DNA

hybrids, that is, where one strand is DNA and the other strand is RNA. Such

hybrid, double-stranded nucleic acids exist temporarily during transcription.

This has led to some speculation that in the cell the DNA double helix may

assume the A-conformation just prior to transcription. Other, less well-studied,

double-helix conformations have been shown to exist under appropriate condi-

tions, for example, C-DNA. In double-helical DNA, the C form is favored only

at very low ionic strength. It is therefore believed that C-form DNA is unlikely

to occur in living cells. Many other double-helix conformations have been dem-

onstrated to exist under varying conditions. In all, about 20 different conforma-

tions of DNA double helix have been described and named, using up most of

the letters of the alphabet. However, in contrast to A-, B-, and Z-DNA, most of

chapter 10 Nucleic Acid Biophysics 225

these additional conformations are only observed in synthetic DNA molecules,

under laboratory conditions, and are currently not believed to occur in nature.

Local DNA Secondary Structures

So far we have focused on DNA secondary structure in terms of various con-

formations of double helix. But in DNA we find also other secondary structures.

FIgure 10-2 • DNA double helix in the A-form and

Z-form conformation.

226 Biophysics DemystifieD

These structures are often found in combination with the double helix, and are

typically localized to a specific location along the double helix. The simplest of

these is a sharp bend or kink in the double helix. Such a bend or kink might

occur, for example, where a stretch of double helix in one conformation meets

a stretch of double helix in another conformation, for example, where B-DNA

meets Z-DNA or A-DNA; See Fig. 10-3.

In some cases the nucleotide sequence itself might create a propensity toward

a curved or bent double helix. How so? Much of the energy required to stabilize

the double helix comes from base-stacking interactions. But the stacking interac-

tions between various nucleotide bases are not all equal. For example, the free-

energy change of stacking an adenine on top of a thymine is 20.78 kcal/mol.

Whereas the free-energy change from stacking adenine on top of guanine is about

21.19 kcal/mol. Both are negative and so both are stabilizing interactions, but

clearly the A on top of G interaction is more stabilizing than A on top of T. It

takes a lot more energy to disrupt an AG stack than and AT stack.

FIgure 10-3 • Bent double helix, where

B-DNA meets A-DNA.

chapter 10 Nucleic Acid Biophysics 227

In solution, such as in the cell, molecules are constantly moving about and

bumping into each other. Such bumps are more likely to temporarily disrupt

or spread an AT stack than an AG stack. Therefore, over time, the average dis-

tance between adjacent adenine and guanine residues will be less than the

distance between adjacent adenine and thymine residues. In other words, the

more negative Gibbs energy change for an AG stack represents a stronger

attraction due to the aromatic stacking interaction, and therefore the bases are

on average closer together. If the nucleotide sequence is such that, as we wind

around the helix, most of the stronger base stacking interactions occur on one

side of the double helix, and most of the weaker base-stacking interactions

occur on the other side of the helix, then the double helix will tend to bend

toward the side with stronger base-stacking interactions (where the bases are

on average closer together) and away from the side with the weaker stacking

interactions (where the bases are on average further apart). See Fig.10-4.

FIgure 10-4 • Curved double helix. If the

nucleotide sequence is such that, at least for

some portion of the double helix, there are

stronger base-stacking interactions on one side

of the helix, then the helix will bend toward the

bases where the stronger base-stacking

interactions pull adjacent bases closer together.

228 Biophysics DemystifieD

Other localized double-helix secondary structures include single-stranded

loops, bubbles, hairpins, stem-and-loop formations, and cruciform structures. A

single-stranded loop can form within the double helix where a portion of the

nucleotide sequence on one strand is not complementary to the other strand,

but the nucleotides surrounding that portion are complementary to the other

strand. This is illustrated in Fig. 10-5a.

As a secondary structure, a bubble is simply a portion of double helix that is

unwound (see Fig. 10-5b). Bubbles can form in two ways. A portion of the

double helix can be permanently unwound if that portion of the double helix

contains bases that are not complementary between the two strands. This is

unusual and not often found in nature. More often, however, although the two

strands of DNA are entirely complementary, a portion of the double helix can

unwind temporarily forming a bubble. This temporary secondary structure can

be recognized by proteins that bind to DNA and thus serve a biological pur-

pose. Unwound portions of the double helix are probably the most common

biologically significant secondary structures found in DNA.

Hairpin, stem-and-loop, and cruciform structures can occur when a nucle-

otide sequence contains a palindrome. In molecular biology, a palindrome is

defined a bit differently than it is for words or sentences. A word or sentence

is considered a palindrome if reading it forward or backward gives the same

result, for example the word racecar is a palindrome, as is the word rotator.

However, in molecular biology we take into account the complement of the

nucleotide sequence, that is, the sequence of nucleotides that base-pairs with

a given nucleotide sequence. A nucleic acid palindrome is a nucleotide sequence

that is its own complement when read backward. For example, consider the

sequence

AATGCGTGGTACCACGCATT

(b) Bubble(a) Single-stranded loop

FIgure 10-5 • Some localized DNA secondary structures.

(a) A single-stranded loop results if a portion of the

complementary nucleotide sequence is missing from the

opposite strand. (b) A bubble occurs when a portion of

the double helix unwinds.

chapter 10 Nucleic Acid Biophysics 229

The complement of this sequence is the sequence of bases that pair with

each of the bases listed. T pairs with A, and vice versa, and C pairs with G, and

vice versa. So the complement is

TTACGCACCATGGTGCGTAA

But notice that this is just the same sequence read backward!

Nucleic acid palindromes can be contiguous, as in this example, or can con-

tain intervening sequences that are not part of the palindrome. For example,

ACGCACCATGCTGTTTGGTGCGT

has the palindrome portion of the sequence is shown shaded. The intervening

sequence, TGCTGTT, is not part of the palindrome.

Palindrome sequences do occur quite often in nature, at least much more

often than one might expect if an organism’s nucleotide sequence were entirely

random. The types of secondary structures that palindromes can form depend

on whether the nucleic acid is single stranded or double stranded and on

whether the sequence is contiguous or noncontiguous.

When a palindrome is single stranded and contiguous, a hairpin structure can

form. One end of the palindrome is complementary to the other, so the nucle-

otide strand is able to fold back on itself and form base pairs in the region of

the palindrome. This is illustrated in Fig. 10-6a. The hairpin region is a double

helix even though the nucleic acid is a single strand. This is an important point

to keep in mind.

If the palindrome is noncontiguous (i.e., it contains an intervening sequence),

then when the strand folds back on itself, the conformation is a stem-and-loop

structure: a stem where the palindrome bases are self-complementary, and a

loop where the intervening sequence is not self-complementary. This is shown

in Fig. 10-6b.

When a palindrome sequence occurs in a double-stranded DNA, each of the

two strands contains its own palindrome. One palindrome is the complementary

sequence of the other, and both palindromes (by definition) are their own comple-

ment when read backward. The result is that both strands are able to form either a

hairpin or stem-and-loop conformation (a hairpin if the palindrome is contiguous

or a stem and loop if not). When both strands form a hairpin or a stem and loop,

the resulting structure is called a cruciform. See Fig. 10-7. Some cruciform struc-

tures have been shown experimentally to be binding sites for specific proteins. They

also can have a significant influence on tertiary structure of DNA.

230 Biophysics D e mystifieD

(b) Stem and loop(a) Hairpin structure

FIgure 10-6 • A single-stranded DNA or RNA

palindrome. (a) in a hairpin structure. (b) in a

stem-and-loop structure.

FIgure 10-7 • A cruciform structure can occur when a double-stranded

dNA contains a palindrome.

chapter 10 Nucleic Acid Biophysics 231

DNA Melting

In Chap. 9 you learned that when a protein is unfolded out of its natural con-

formation, it is said to be denatured. Denaturation in DNA also refers to the loss

of the molecule’s typical secondary and tertiary structure. In DNA this most

often means unwinding of the helix. But it is not necessarily the case that an

unwound DNA helix is out of its natural state. In fact, formation of unwound,

single-stranded regions in DNA is a natural part of DNA function. The DNA

double helix must unwind for nearly all of its biological activities (transcription,

replication, etc.). For this reason DNA unwinding is commonly called melting

(although the term denaturation is sometimes still applied).

Denaturation and Helix-Coil Transitions in Nucleic Acids

and Proteins Compared

Another term used to describe melting and denaturation in nucleic acids and

proteins is the helix-coil transition. In this context you should always remember

still struggling

Primary structure in DNA is just sequence of nucleotide residues making up the

polymer. you just learned about a lot of different secondary structures in dNA.

To try to simplify matters, let’s briefly review them here. Both single-stranded

and double-stranded nucleic acids form a helical secondary structure due to

base stacking interactions. When a nucleic acid forms a helix of two strands

(double stranded), we call it a double helix. Even within the double-helix second-

ary structure there are various conformations. These include A-DNA, B-DNA,

C-DNA, D-DNA, Z-DNA, and others. These differ from each other in terms of tilt

of the base pairs, helical pitch, width of the helix, size of the major and minor

grooves, helical direction (left-handed vs. right-handed), and so on. DNA-RNA

hybrids, where the double helix is one strand of DNA and one strand of RNA,

occur briefly during transcription. Evidence suggests that while B-DNA is the

most common conformation in nature, DNA-RNA hybrids are most stable in the

A-form conformation. In addition to the various helical conformations, local sec-

ondary structures also occur, for example, kinks in the helix, bubbles, loops, hair-

pins, stems and loops, and cruciforms.